Description :
From Genome Similarity Track
Location :
Scaffold_84:47071- 48335
Transcript NameFunction/comments
Physo_140283reverse transcriptase

Sequence
1264 bases(100 bases per row)
TTCGGACGAGTCTGTTGTGGAAGCGAAGTCGGAGCCCGTGCGAGCGAAGGAGGAGGCGAAGACGCAGGGTTCCAAGGTGAATTCTGGGTTCGCACCACCT
GAACCCAGCGTTTCAGCGCCAAGTTCGCAAGCGACATCCGGGAAGTTGCTGCGCCTGCTCCGGAATCGGGAGCAGCGGCGTTGGACGCCGGGAGCATGGT
GCTGTACGTTCGACGTGAAGTTCGATGCTGGGAAGAGGTGAATCCTGGGAAGGTGACGCCGCCAAGTGTCGTTTATGAGTGGCCGACTCCGAAACCGGAT
GCCAACTCGTACTTTGCGGCCGCGTACACAACGGGAGACTACCTCAAGTGGCGTTTGTCTCTGGAGAATCAAGATGAAGCCTGGATCTCTGAGTTTCACC
TCGCCCGATGGGGCGTCGGAACTGCTCAGGATCTCATGGCGACTACGATTCCCCAGAGTATCATGACCACCCGCGAGTGTGTCACCATTCTGCAGACTCT
GTTCTTCGAAGCCGGATTTGAGTTTGTCAATTTGATCCCTAGCTGGTCTTCGACGCGTGCTTCCAGGATTCCAGAAAGTCTGGTGCGCTCTGTCATGGAG
GAAAACCAGAATTTCATCGCCGTGGAACTGGTCGAGTGGAGATTGGTGATAGCTGGTGTGCCTTTCAAGGTAAACTCTGAAGATCACGCCGCACCAAGCG
CCCAAGAGCAAGCACCAAGACTGGACTACCACAAGGAAGATGGAGACGGTGATCTATTGATGACGGACTACGATGCGGATCTACTGGGCCGACAGTTTGT
CCTGAGATTCAGAGTCACTGGACTCAGGATTTCAGGGAGCCCACGAGGGTCGAGTGATGGTGAGCCACGATCCAAGCGTATTCAGCATGGACCGCCTCGG
CCACAAGTCCCGTCAACGCCATCCGCGTTGTCTACACCGTCGCTGTCCTCTCTTCCAGCGTACAAGTCTTCGACTGGTGCCTCGCTTCAGAATTCCACTC
CCCTGAATTCCGTGTCCAATGGACGTGATTCTCTGGAGGCGGAAGCCAAGGACGCTACCCCAGGCGCGGTGCCAAGTGTCACCGGTACCTCGCGCGCTTC
GGATGAGAGTACTGCCTCGGGCGTTCAAACGTCTTATGGTAGCTCTTCGTCTTCGTCGATGATGTCGCTTGGACAACGAGTTGGAGCTCTAGCGCTTGTG
GCCTAGAGTGCCGGTGGCTTTGCAGCTGCCGGGGATTTTGGATTTCAGGTCACCCGGACAGTCA