Description :
From Genome Similarity Track
Location :
Scaffold_33:47062- 52807
Transcript NameFunction/comments
Hyaar_Emoy2804910hemicentin, putative

Sequence
5745 bases(100 bases per row)
TACGCACCAAATATTCGGGCTGTGCGCGAGGAAATTTTCGTGGGCGCCGCGTTTGGAACATGCCGTCCGTTAGCGTTTTATTTGCTGGGCGACTTCAATT
TTGTCCAGAGCCCGCAACTGGATCGGTTAGGCCCGCGGACAGAGAGCTGTCCGGAAATTTCGGAACAGGGTTCTCTGTTGGGGAAGTGGCCCTAAGTGAT
GCCCGGCTGTTACAAGAAAATGCAGCGAATTACAACGAATACACTAGTCATCACTGCACGTACTAGGCCGAGGCTTCGGCTAGTCGGCGTGATAGATTCT
TCGCTCCTGATTCTTGGGCTCTGGACGTCCTGTTGGTATCTACGCCCCCCCACAACCCTCCGATCACGAGCAAGTGGTGCTACACTTACGGGGAAAGCGT
TTGGGTAGCCGATCACTTTTCCTATCCTATCCATTTCAATCCATCCTCACCGCGTATCAACGGACTTCATTTAGGAAATGATGGTCGCGGGTGTGGGGAA
ATTGCCGTCTGTCCAGTCCTGGGACACTTATATTGCTCAGAGCATACACTTTATAAAGGTGGTGCGGAAACGGGAAAATCAGCGGCAATAACGCTCGGTT
GCAAAGCTCCGCCGACTAAACAGGCGGCAATTCCTAACGCGACAGCAATGGATATCCACCAATGTAGAAAAAATGCATGAGGACCACCTGGATCGTCCTT
AAAAGCTTTTTGCGCGGACGACGGAGCGTCTTCTTTGTTCCCGCAATCATATTGCTGATTGGGAGCGAGATCAGCGCATCACTTCCCTGAAAGCCCGTTA
CGGACATGATTTTATGTGCACCATGTCGATCGCGGATCCATTTGCATCTGAATGGGCATCTGTCCTGAGTCAGAGTCATTGCACCACTTCTCTGCCTCTA
CTGGCTTTCAAGATTCGAGCTTTTTTCGCGTCCATACCGCCAGAATAAAGTTTGATAGCTGACGATAATGAACGCTAGTTAAACCCCGTACGGAAGCAGA
AATGCTCTCTGATGTCAAAGGGCTTAATCGACATAAATCGGCCGGTCTTGATGGGCTCAGCAACGCCTTCTACAAGAAGACCGTAGGGGTCATGTTCTCA
ACGCTGGGTAATATCAGTAACCAAATAATCGAGGGGTCGGAGTTGCTCCCCTCCTTCCTTGAGTCCCTAGTTCTTCCTTTTCGTAAAAAGGGCGACTCGG
ACGATTCCATGTATTATCGGCCAATCGCATTCTTGCGAAAAAGCTACAAAGTCTTTACGAAGGTGCTCGCAACACGTCTACAACACGCTTTACCCAGGAC
TACAAGCGACTCGCAACAACGTTTTTTCCACGGCCGTAAAAATGGCAAAGTCGTTTATATTGATGTTGGCTCGGATCACGACTGCAGTAGTGCAGGACGA
CATATTGGCTGAGAAAAGTCAGTGTATCCTACTTTTGGTCTTTCGTAAGACGTACGATACGGTAGACCGAGATTTTCTCGTCGAATCGATGCGGTGTTTG
AGTTCGACGAAGGGTTTGTCAACCTCACTCGATGCATCCAGACCGGCCCGTCAGCCCTCTTTGTTGTAAGCGGAGACCAGTCCCAGATACTCCCGGTGAG
GTCGGGTATTCGGCAGGGATTTCCGCTTGTGCTGCTCTTAATTCTATCGGTGGTGGGGGCTTTGGGGTTAGCTTTACAGAAGGACCCAGGACTTAGAGGA
ATCGACGTACCAGAGTTGCAGCGGCAAATGCACATATATTCAGCGTTTGTAGGCGACCCCACGCTATTCCTCGCGCATGCTGGGGAGATTCCGCATGCTT
TACGCATTTTCAACGGTTGTAGTGCACTGGAGGGATTACATGCCCAACTGATTAAAAGCAAGCTTAATTTTCCTTTGCAGAACAATAAATGTTAAGCACT
ACGAGGTGATCGAAGTTTTGCCGCCCGAGTGCACCACCAGGTACCTGGGTTACGAGATCAGTAACGGGGACTTAAAGATCAAGAATTGGGCCCTCCGGAT
CCAGAAGATTCAAGGACAACTTAGTACGGCAACTCGGGTCGCCACTAGTGTGGTGAACATGGTTCTTATTTTAAACTCCATCGCCCTTCCTTCAATTCTG
CTCACATCGAGCGTCGTCGACATTCCCCTGTAGGCGGAAAAGAAGCTACACAACCTCAACAAGAATTTTCTATGGGCACACGCAACTTCGACAGACTCCA
GGCGCAATAAGGTCAACCCAGCATGTTGATAACGCCACAACAGGCGGGCGGAATAGGGCTCGCTGATGCGTCGGTAGCAGTAAAAACACAGCGGACCAAG
CTTGCCATGCTTTGGCTCACCCAACGCCCGGAAAAGTACTTCCAAGCCTGGCATGTATAGGCTTTTTGAGGGTTGAATCATAATACTGCAGGACAGTTTT
CTCCTGCTGCGGTACTGCAATAATTAGTGTCCGGCCGACTCAGTACCTCTGGGCTAGATTTGGAAAGGGTATTAGGGGCCTTGTAAGCCCCAACAATTGA
AGAGCAACACAAATCGACCGAATGGGTAGCGACACACTCTGCGGCGTTGCTTGACGGGGCAAATAGTTAGTGGGACGGAGACGAATGCGTTGTATCGTTT
GCCTCTCCTTTCCCAACCGACCTCTGGGCTCCGATGACATGCCGGCAGATCTCCAGATATTTTGGTCCATGTTTCAGTGGCCGCAGAACCCATTGATCCG
CGATTGCAGCGGCTAAATGTTGGTCTCAACTACATTTACTAGGATTGAGGCATGTACGCTTAAGAAAAGGTTTAATGCGTACGGGACCGGCATACTTTGT
GGTGACAATACCCACTCCCGCTCACCAATCCAGTCATCAATCTGCCGCACACTTACGGCGGTGGGCGACCTGTGTTCTCGTCTCTTCGCCGGCCACAGCA
GTCGGAACGGTTATCCACCGGAATTTGGCACAGAGACTCCGTCACACTCCTCAAGTTCTGTCGGCTATGCATGGTCGCTGACTTGAGATGGTATCCCATC
CGGTAGACCACCGGAAGCCGCGGTATATTACGAGCGCATCATCACTTTGTACCAAGCCGATAACGGTATGCGCTGGAGGTGTCCAGGAACATCCCGGAGT
TTGCCGTTGGGCTCCCAAAGAAACGACAGGTGCTCCGACAAGAATATGTGAGTACGGCCTCGTCTCGAGGTGCGCCTACTATTGCACAGGTTCTCCTGAG
TGGTCCCTTATACTACGCCAAAACGGGCCATAACAGTTGCGCTAAAATGACAAGCATTTTACCTTTATACTAATGAATTGGCCCGTCCGCTCGGAAATTA
CTTTAACCGTATGGAAGCACGGGAGGGCGGGACGACTGAAAACGGGCGTCCCTACGTCAAACCCCGCAGCAAGTATGAAGACATGGGCAGGGCCTTACAA
CCTATCATGTATGGACGGGATATAGGATAGCGACGCGGCAAATAGCCTTGGATCACACTGAAATACACGAGCACAACACCTGCCACAAGGCCCCTGGCTG
TAGAGAATATGTGGAGACATTGCAGCACTTATTCTGGGACTGCTCATGCGACGTCGCCTCTTGGGACATGCTGATCGGGCACTGGACAGGAAAGAAGTAA
TCCATCCAGCACACCCAACAATTCCTCCGCGCATGTTCTAGCAGAATAGTCGCCAGTATATCCGCGCACCGGAGGGAAATCCCCTCCCCACCGGTTTCAC
GAGGATTGTGAAGAGGCGGAACGGATGTGGAAGCGTATGTGGCAAATTATCGCGACGATATGTCAAAACCCATCTCTGGACTGACAGGAACGATGCAGTC
TATCAGGGAGCTACAAAGGATATAACCAGAACTGCAATACGTTTCTGGACTACAAGCATCCGCCAATTGCGCGCTATCGTGACCCGTGAGCATTGCAGGG
TGCCCTTGGATATTCTAGGAGCCATGGTATATGCATGCATCTAGTTACTCGAGCACGAACCGAGTGGACCAACAGGCATTACCGAGGCCACCCCTGGTAA
TCCATTGGAATCTCCAGCGCTGACATCATGGCTCCAGCTTTATCTGAGATCTTGCACATAGTTATTGCTGTGTAATTAGACTATATGAACACACATAAAA
AATCTATTGTGTCGTAAGGACTTGTTTTGTGCTTGTACTTGTTCATATAACTCTAAAACTGATCCATTGTTGGGTTTTGAATAGATGGATATCCCGATTG
ATTTACGCTGCGGTTATGGACCTGTTACCTCACAAGGCGACTCTGTTCAAATGCAATGGGTCCGAGACGGCAGACGAAAAGTAGACATTCTTTTACGCAT
GGGTAGCGGTGTAGACGACGATTTAGATGTTTACACAGGGGAGAACAATATGGGTGTTGTTCTGAAAGAATATGCGATGAAGAATCAGATACCGGAAAGC
GACGCAGATGGTGCTGGAGACTACATCAAAAACGACGACAATGACAACGACGATGAGACGGTCACAGGTATTGCTGGGCAATCCTCAGTTGTATTTACTG
AGTTTTCGCGAACACCTGACCGATTTTTTCAGCTATCGATCGTGAACGTTTCCAACACTAGAGGCAGGATAATAGTTATTGTTAGATGCCTTTCGCTGTA
CTTCTTCAGCTGTAAATTATATGCTCCCTCTGTTTCGCCTACGTGATAGTTAGTTACGAGCACGTAGCAGAGATATTAACGTGGTAGAATGGCTACATTG
ACGGATTAGCAACAACTACGACATGAAGACACATTAATGGCGACATGTTTGCATTACGATTGTTCATCATATCTCGCCATCGCACACTAGTCTGAAAACA
GCATACAGCCATTCTCAAGTTGGTTTGTTTCGCGTTGACACTACCGACATCCAGTGTGTACCTTACTCATTCGGACTAAACCTTGCTGCATCCGAATCAC
CGCGGCTTCTGGCACGGACACTAACTTTGTACTGCGGGTGATCGTAATTTTTCATGTCGTACCACTGGACCATTTATCCGTGAGTCGTATAGTACGGATG
GAATGATGCATTCATGTCTACTCCGTACACGATGAAGTGGGTACTGCAACTTGCTTGACACCAGGCCGGATATGATAATCAAAACAACGGTATACATTGT
CGTCTCTCGTTCGACGCATACCTGACGATCGAGTCGCTGTGTAGCGGAGCTACCCTAACTCCTTTGTCAGAGGAAGACTTCTAGACTCGCAGAGTCTCTT
AGTATATCAAACTAAACGGGTATTAACTTTAAGGGTCTCAAGTCTTGTAGACTTGGTGAGACTTAACTCTAAGTGTATGTACAAGCTCTTAAGCTTCTAG
TCCTGGTTCAGGAGACTACGACTCCAAGGAATCAAGTGACACTAATACCAAAGAGTACTTAGCCTTAACTCAGGCACTTTACTCTTACGACCAGAGACGT
CGTAGAAAGACACGTGTCTGAAAGATCAAAAGGGGAACTGAATGTATTTACAGATTTACAGCGATGATAAACATTACTTACGTCTTTAACCTTAAAAGCT
ATGCTACCTAACCGAATAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAGACCCTAATACTATAGATATCCTCTAA
CCATAAACGATAGGTACGGTATCATCGCTTAGCGTATCTGATAGAAAAGTACGCCTTATCAGTGACGCTGATCTCTTTCTGTGTGTACCACACCAACGTA
CCTGGTTATCACAACCGTTTGTGTAACCCCGTTACATCCTCCCCC