Description :
From Genome Similarity Track
Location :
Scaffold_1383:4706- 7273
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1383-snap-gene-0.7Conserved gene of unknown function

Sequence
2567 bases(100 bases per row)
TGCAGTTTCTCAAGTGTGTCGAGAAGCTCCAGAGATCGCTCCAGAACAATGTTCGACGATCGTAGGATCGATTTGGACGCATCAAGGGTCAGATTTGCCA
AATGTGGTATTTGTGTCGATGAAATCCCTGAGATCACCTTTTCCACATGGCGAGCCTATGCGAGCCACGGCAAAAAGGTGTTACTGGCTATGACACTGTC
AAAAACATTTCAGCACAAAATAAAACTCACCTGGCTCATGACTCCTTGAACTTTTCGTGTGATAGTATTGTAGCTGCATGTCATCTGGCCGCATACTTGC
GGCAGAGTTTCTTGCGCATCAGTGATATCCAACACGCCCGATGTGTGAATGCCTTGCTCGGGCTTGATGTCCTTCACCGGCACAAACGCGAACAATTTGG
CACTGAAAGTGCATTGCTCCACTTGCTTGAAGTCGTAAAAGTGTGCTTTCGTGTCACTGTTTTTTGTTGGTACCAGTTCCACTGAGAGAGCCATTCGCTC
CCCGCTGTTGTCACAGGTATCGCCGTCATCGAAAAGCATGTATTTGTATCGCATATTAACCGGATCAATTTTCCATCCGCGGAAAATGCTACACGATGCG
TAAAGAAGAATGCGATTGTAAGCACTCAAATAGCCTAACTTATAGCAGAAGGATAATCGCCACGTACCCAAGAATCTTCCTCATTGGTGGCTCTGAACGC
TCAGCTTCCTCGGTCTCCTCTGCAGCTTCAGGCTTCTTGGCCACATACGTAACGTTCTTCAGATGGCAAAAGTCAACAAGCGCGCTATTTACACACAAGA
TCAAGTTTAGCGCACGCGCTCCGCGACATAATAAACCAAAGGCCAACAAAGTTATACAGCAACAACAACACTGACCTCTCCGTATTGATAACTCCTGGAT
TCTCCGTCAGGCATTCCAGCGAGTCGGCAGAGGACGTGAATGGACCTACACGCAGCATATCAGACGCACGCCGTGTTACTAAGAGCGAGGCAAGGCGCAT
CGATGGGGAGAATAAGCGCAGGACAAACCTTGGAAAAGCACCACGGGCTCTCGGAACGGCACAGGTCCCTGCGGGCCTTCCTCGGCTGGATTCGTTCGCG
GCACGATCCGAATCCCGACTTTCGGAGCTGCCGCGCACATGGCACTCGCGATCACCAGCAGTACCGCGATGTATATCACACTGGGCATCGTCCTTGGAGG
CGTCATTAGCCGCATATTGTCGCCTCTCCGTCTCAGTGGTTTTGCGTCTCTTTCACTATCGAAATGCTTCACGCACGTCGACGTGGCTGTCGAAACAGAA
ATGAGAGCAACGCAGGTATTGTAGTTTACTATTAAATGTATTTGTGGAGGTATATGTATTTTTAGAGGGTTTCCTTTGCTTGCGAGTTGAAGTTCGGAGT
GATGGTCAATACTGTCGCCATTCCGCATTCTTTCTGTGTCTGCCATTCCGCATTTTGCCACGAGCGAGAGAGAGCAAGAGAGGCGTTGAAAATGGACACC
ATAATGGAGATCACGAAGCGCGTTGAAGCCGCAAAGGTTGAGCTTGAACGATTGGCGCGATCAAGTAGCAAGCGCAGTATTGCAACTTTGAATAACAATA
CAGAAAGCGCCGCCAGTTTGCAACGAATCATCAACGAGCTGCAGCAGTTTGTGACCGAGTTTAGGAATGCGTCTGTGTTAGACAGATCGAGGAGCTCGAC
GCTGATGGAAGCTGGCATAATTCTGTACAACGCTTCCAGAAATGCATTCAAAGCAATGCCGAAGAGCTCAGTTATACAGTGCGACGACAAGAAGGACGAG
GAGGCTTCGAAGAGAAGACACGAGACAGAGTTTGCGTTGCGGAATTGGATTGTTATGGCAAGGTTCTGGGCATGCAAGATTATGAATCTATCTCTAATGT
GCTCGAAAAGCGGCGGGGTATTGGACCAGAGTATCACCAAGAACCAGCCCCAATATCTTGATGAGTGCATTGATGTGCTGCGATCGTTTGGGCGTGTTGG
AGCGTTATTTCTAGAGAGTGCGAAGCATGACTTCGGCCGATGTCAGCATTACTTGAAGGTCGCAGAGGAGTCGTTTTCGTACTGCTTTGTAATTTGGTCT
CAACTCGGGTTATCTCACTTGACCAAATTGAAGCAAGACCTTGAGCTAGAGGAGATCATGGAAGATCTATGGGACTTCAGCATGGATCGAATTCGAGTAT
TGCAGCTGCTTTGTGGCGATGACGATGCCTGCAAGTCCAGAGATACAAATGGACTTGTCGAAGCGCTGAGTGAGTTGCAAATGCTCGTTCCGTATATGCC
AACATACAAAATCGATTTGCTGAAGTTGGTGAAAGAAACAAGTGAGATTTACAAAAAAGCTGGACGACATCAAGAGCAAATCATGCTTACCGAAGAAGCT
CTCCGTCTCTGTGATTCGCTAGACGCAAGTACGGAGTCAGGTGAAGAACATGTGCTGCAGCAGTTCAAGCAAAGCTTGCTTGTTAACATGCTAGACACGT
TTGGAGCGATGAAAGACCATCAAAGAGCAGAGACGTGTTATTCTCTTCTTCCACAAAGTCGCGACTC