Description :
From Genome Similarity Track
Location :
scaffold_28:47056- 50407
Transcript NameFunction/comments
Pl_111801conserved hypothetical protein
Pl_111802hypothetical protein PHYSODRAFT_532657

Sequence
3351 bases(100 bases per row)
CTGGATACTCTGTTGACGGCAAAATGCTCCAGCTGGTCGTTGGCAATCAAGCTCGTCGAGAATCGATGAAGCGTTTACGGCAGGAAGAAGGCCTCATGGA
TATGGGCGATAAATTACTTAAGTAGTTACAGTACGAGGCTCGCTGTGCAGTAGGTGTCCGTAATCACCTCCGTATGCGAACGCTATTCTATAGGGTCTGC
TGTCGTTCACATGACCCGCTGGCGCTTGAGAGGGCCACCGCACGAAATCGATGGCATCGTACAGCGATCAGCCTCCGTGCTTTGGTACTTGGTCCACATG
CGGGCCAGCATGGCCTCCTCCTGCTTCCGGCGGATATAGCTGCTGTGCGCCGGCAGGTTGGCGACCGCGAGACATTTAGGGGCGACAGGCGCGCACTCGA
CGAACAGGCTCGGATCCAGTTCGTTCAAATACTCGTCGAGGCTGCGGATGAGGACGCGCTCAGCGGTGGGCTTAGTGATCTGCTGCTGCTCAAGCTGGTT
CTTGCGCTCGAGGAACTCCTGGATCTCCTCGTAGTGGCTGCGCGAGCGACTGTCGTGTACGCCGAGCAGTTGGCTCGAGGCCTCGTCCAGTCCGCCGACC
TGTGCGCAAATGTACTGCTGCACCTGGTCCATCTCGGCGCGGTACTGCTGCTCCTTGGCAGGCGACGCGAATCGCAGCGGGCGGCGCACGATACGGCGCT
GCTGCGGCTTCACGCTGTTCATGGTGCTTTCGGTGGGCGCTATGCGTGCTGGTCTGCAAATAGCGGAATGCCACCGAGCTCGGAGCTCCCGGCACCGAAG
TCCTACGGCTGTTACTGCCGCTTCAAGCAATGCGATTTGCCCATCACCTTTCCGTCACAACGCGACAACGGCCGTGACACCTAGGTACCATCAGTGGATT
CTTCTTTGATACCTACACCTCGGAGATAAAGGTCTGTTCTAACGGCGTTTGTATCAGCCCCTATAAATCGATGTAGCGGTTAGAGACAGGATATCCGAGA
TTGCAGGAAAGGACCAGAGGCATCTGGTTCTAAAAAATCGGGAAAAAACAGTCGAAATTTAGCTTCCGCATACAATTTCCAAGACGTGCGAAATTCGACC
AAAGCGGCAACATCTTTTGGTGAGCGATTTGCAGGCTGAGACGGCGACGCTGGATTATTATCGCGCCGTGCAGGATATTGCCTCAGCGTTCGTTCGTTGA
TGGCGCGCGGTTGGTTCTGGAGCTTGCATGATCACCGCGACGAACAACAAGTGTGGGTTCAAGAGCTGTGTGTCCATCGGCAGATCGGATCGGTCGCGGT
GCAGCGCTGTGCGATGTCAGATGGTTTGGCTCCGCTGTCAACAGGCCCAGCCTGTGCTTTGTCGGTTGATTCTTGTCCAAACCGCGATGGGATCTTTTCA
GTGGCAGGTTCGCAACTCGTGGCGGTTCATAATGATTCATCGGATACTAGATAGGCCGAGCGTGATAGCTTAACTGGAGCGCGATAATTTAACTGGAGCT
CAACTGGAGCTACACAGCACAGCGTGTGGCATATAGCTAGTCGAGAATCAGCACAACTATAGGACCATTTGAGACCACTTATCGAAATTGGATATCGATG
ACATCATTTCAGCCAATCCGATCGCTCGAACGGGGGATTTGTTCCATTATCACGTCGACGCCATGGCGGAAGGCGCCGAGCGCGCGCTCCTGGCCAGCGG
CTTCCTCCTCTTCTCGTCGACTGTCGTGCTCTTCTGTCTGGAGCGCAAGCGCCGACGTCTGCGCGCGTGGCGGCAGCGCCTCACCTACAAGAAACTCTCG
AAATCGTGCGCTAACTCCGCCCTTTGCGTTAATTCTCGGCTCTAACAACGTTACTGCGCTATAGATCGGATCTAGGGGCGTCATTTGGCTTGGATATCGG
TACGCCACTAGCTGCAGTTTCACTTAGCGACTCGAGACTTACCAAAGTACTGATATAGGGGGGACGCTGGCTAAGATCGTGTACTTTGAACGCCATGAGG
CTGGCAACGACAAGCGCAAGCGGCCGCGCTCCGAGTCGCTGGACGTGGCAGCTGGAGAGATGAACAAGTTTCTGCGCGAGCACCAATCGTTCGGCAGTAC
GGGGGTGCAGGATGTAAGGCTGCGGATCCACTCCAAGACACTCAATGGAGTACGTTCCAGTGACAGATTGTGCTGCTTGCTGCTGTCTCACAGTTGATGT
GTCCAGATCTTCCACTTTGTGCGGTTTGAAAGCAATAAAACTCAAGAAGCGATCGAATTTATTGCAGCCAATGGAATAAATCAATCGCTGCGGATCTTGC
CATGTACTGGAGGTGGAGCTCACAAGGTTTGAAGTGCGACGATTTTGAGGTTGTGATAATGGTTTACATTATTTTTTTGTAGTATGGACATGTTTTCAAT
GATATGGCTGGAATTGAACTAGAGAAGTATGATGAGATCGACTGTACCATTCTGGGACTGCATCTGCTGCTCACTACACTGTCGGATGAAGTGTACGCAT
TCGAGGTAAAGAAATGATTTATGTGATGGTTGTAGGAATCAGAGGTTAAATTACTGTATTTGTTGCAATGCAGGTTGTAGATTTCAACTCATTGGCAGCT
TCCCGCGTGAAAACTGTCCAAACTGACGCAGACGAAAGCCTTTACCCATATCTGGTGTGTTTCTTCCCTTGGACATGCGTTACTGCTGATGAATGTCGAA
CCTAACCGTGTTCACTGCTCTTGTATATTTTCTGCAGCTTGTCAGCATCGGCTCGGGTGTAAGCGTGTTGTATGTAAAGGGACCAGGCGACTATGAACGT
GTGAGCGGTAGCAGCATTGGTGGAGGTACTTATTGGGGGCTGTGTCGTTTGATGACCCACTGCGAGTCGTACGACGAAGCACTGGATTTGTGTGTCCATG
GATCCAACCAATCGGTTGATATGAGTGTGGGTGACATCTACGGTGGAGCTTACGATAAGTTCAAACTGCCGGCGTCTGCCGTGGCAAGTAGTTTTGGCAA
AATGATCTCGGTTTCTCGCGAAAGCGTGAGTGAAGCCGATCTAGCTCGATCATTGCTAGTCATGATTACCCAGAATATTGGCCAGGTTGCCTTTCTGAAT
GCGACATTGTACAAGACCAAGAACATATTCTTCGTTGGAAACTTTCTGCGGCACAACAAAATTTCGGCAAGAACGTTGGCATACGCAATTAATTTCTGGT
CTAACGGAGCGATGGAGGCTCGCTTTTGCAAGCACGAGGGGTATTTAGGGGCTTTGGGGGCTTTTTTGCGTCACGCAGAGGCGACAAACGCTCACGGTGA
AGAATTTATTTCGGCGACACGAAGATCAAGGTAATCATGCTAGGATATGAG