Description :
From Genome Similarity Track
Location :
contig_8:470531- 472109
Transcript NameFunction/comments
g1635.t1hypothetical protein

Sequence
1578 bases(100 bases per row)
TTTTTCAGCCGTGATCTCACTGAATTATGTTTACAATTCTACAGTATTATTAGATCCTCTTCTAGCTGACGTTTATTGTCGCTTCAATCTCTAGATGACC
TCCTTGAGACGCCCGTGGCACCCACAGTACGAGTGAACCACCTCCTGTGCCAGGAAGACCAAAAAAGCCCGGACGCCAGCGGTCGAGGTACAGCGTCTTG
CCTCCCAGCACTTTGGTAGTCGACGTCCACGTTGCGTTCGCCCCTGCAGCCACATCGACTTCGTCAATCTTGTCGCCTCCAGACATGATATTAACCGTCA
CATCTTTTGTATCTGTGCTTGTGAAGTTGATGATGACCGCACCGTCACCCTTCTTGGCCCAGGAGCTCGAGCTTCCTTTGAAGGCCCTCTGCAGCGTGTT
CAAGCCAAGCGTAGCGGCTTCGGTGCCGTCGTCAATCTCGCCCATGAACTGCGTGGGGCCGCACACCGTCTGAAGGTACTCGGAAATCAATGTTGAGAGG
TCTGTGGGGTCAATCATCGACGAGGAGAGAGTGGAGAGACCGGTATCGATCCATTTGTACGCGGCCGCTTTCTCATCCAACGAGGTGCCGTTGTTGCTCT
TGCCACTCTTGACGAGGTCACTTATAATAACGCCGAAGGTCTTACGCAGCAATTCTCTGGTTTTGTACGCAGTCTCTTCGCTGGTTTCGGAGGCCAAATG
CTGCATACAGTTGTTCGTAACGATCGGGATATCGTAAAGAACCAGGTCGGACTCGCTGACCTTCAAGCGGATCTCATCGTCGGATATGTGCGGATTTACT
TCTCTGTATTCGTTCACAGTCAACCAGACACGGTCTGTCAACGACTTCATGTCGCCTCCGCAGCTCGAATTCTGTTGCATCGCCGTTTCGAGCGACTCAA
TCTCACCCTCCGTGATCTCTTCAGCGGCTTCCGTGAAGTTGGCTCCCTTGATGAAGGCCCGGAATCGCCCCCAGCTTGAGATGATATTGTCGTCGTAAGT
GAGGGCTTGCAACAGCATCCACTGCGTGGTGGCCAACACGATCTGCGAGAGCCGAAGACCTGAGGGGATGTCCTTCCCCATGCAGGCATAGATGGCCATG
GGTATATCCGTGACGACGTTGTTTGTCTGGTACAGCATCAGTAGCAGCTTCTGTTGCGAGTCTGCGGGTCTTCCGTCTTCACGTTGCGAACGTATCGGAT
GACACCTCTCATCACCAGGAGCAACTGGTTCGTGCACTTGGCAGCCCACGTGATCTTTTTGCCCAGTCTCGCCAGTTCACCGAACACACACAGAAAGTGG
CACTACTTAAAATGGCCATGGCCAACGCGGAGACCTTGCTGGCGACTTCGAGACCACAGTCGCTGTTCTGTCGGATGCATTCCATGCCGCACTCCACCGG
GAACTCGATCGGACACTCCGTCCAGCACGTGTTGGTTGCCTCGTTGCGGTCGAAGTTGCTCGGGCATACGTCCATCACGTGGGCTTCGCGATAACATGTT
GTGTCTGACGAGATACTCCATGGGCCCACCCAGTTGCGGTAGGTCGACGTGACGGTACTGATGGCCGTGGCAGGGGTA