Description :
From Genome Similarity Track
Location :
scaffold_27:47050- 49155
Transcript NameFunction/comments
Plaha_PHALS_09377reverse transcriptase

Sequence
2105 bases(100 bases per row)
cggaaagtggcgtatcgctcaatGATTGGTCCGTGCCAAACAGTTTAAAACAGCTGAGACAATGGTTGGGCTTGGCCAACTATTTGCCAAAATACATGCG
CAACTTTGCAGCGTTGATACAACCCCTAACGACTCTTTTAAACGTTGAGTGGGAATGGTCAAAAGATCACCACGACGATTGTCCAGTACATATGACACTG
ATGCATCCGAATCTAGGTCTGTCGCGTGCAGAACGGTTTTCTGCCTACAAAAATATGGCggtatttgccgaagtgaagaagagttGGAGAAAACCTCCTC
TTCTTGCGACTGCAAACCACGATAATACTTTTCTTGTGGTCTGCGATGCAAGTGATTATGCCATCGGCTATGCGTTGATGCAAAACGATGATGAGGGCCA
AAAGCGAGCTGTTTCgtatcagtcgcgacgaTACCGGCCTGCGGAACGGACCTATCCAGTttatgacaaagagcttctaGCAATGAGGTATGCTTATCTT
ACGTTTCGTGTCTACTTGCTTGGAGAGGAGCGCTTTGCTATCTACCCAGATAATGCCTCACTGCGTACGGCAGTCACGACTCCTCATTTATCGCAAAGAA
TGCTTTGATGATTTTCcattccttctttgcggtgtATAACTTTGTTGTACACTACAAGCCAGGCATGACGAACATCTTTGTTAAGACGTCCGTACTATGA
CCCAAAGTCCAGGAGCGAAAACATACacgagtcatgtcgacaatgcgaaGATGTTCGGACGATCAGAGTACAAGTAACGACTACAGTGcgcgaagaaatt
gtcgaaggGTACAAGTATGATGAGACATGTCACGACTTGTTGAAGTATTTCAATTAACCTTCCGACAAAGCTCTGCAAGGTTTTCTTCTCGCACGAGATC
GCGTGCTCACCGTGTTGGAGTACACAAAAAGATTGTTGCACTATTCGGCATGAGTTGTTGTTCCAAATGACGAAAAGGTTTGCGTCATCGTATTTTATAT
GAGTACCATGACAGCCCTTCGGGTGGCCATCTCAGACGTGATAAAACGTTTCTCAGTCTATCCAGGGATTATTATCGGCCACATGTATAATTGGGTGCGC
AAGAACTGGTGAGATCTGCGAGAGAGGGAAACCATCGGGTTCCACTCAGACCCCACTTCGGTCCCTGGAAGTATCAACTGACAGCTGTAAGTCCGTGAGT
ATAGACTTCATCTTCGGAATCCCGCGTGACTCACACGTACACAGTGGCATCCTTATGTTTGTGGACCGATTCAGCAAGATCGTTCATCTTGCGCCTGTTT
CTGACAAGAACTCTACCGAGAAGACAGCTAAGGTCATTGTTGACGTTATTTCCGTCTTCATGGCTTTCCTGTTGAGATCGTGTCTGACCGTGACATCGTT
TTACGTCGTAATTTTGGCGTGCACTGATTGGACTATTGAGCACCAAATTGTCCATGTCAAACAGCGGCACACCCTTAAACGAACGGCCAAACAGAGCCTG
TGAATCGAGTCCTGGAAGACGTACTGCATAGTTACGCTACGTCGCTTAAGAGTGGTGTCGATTTCTTCCTCTTGTTGAACAACTTCACGCATGTCTCGAC
AGGACATTTGCCATGCTATGTGAACTATGGTATTCATCCTGGAGTACCTGCTTCCATAATGGGCGAAGTTTACCTTAAGTGGGGGAGAACTACGGCTGTA
GAGCTACAGCCTGAcctaaatgctgtcacagagtttaaagcaaattttgaattAATGAGACCTctagacgacatgacaagtcgtGAGAAATAGCATAACG
ATGACTTTATTGAGAAGAGACTAGCCGTTGTTTGGTTTGTTCGAGACGCAATTGCGAAAGCTCaggacctgcaaaaagaatagcgGAAGGAAAAACAAGA
AGGTATATATGATCAATGACCTTGTACTACTTACCACGACAAATCTGCCTGAACATGCAGCGTCCAACTTGGGAAGCAGGAAACTTTTAGCAAGATTCAT
TGGACCGTCCAAGGTGTTGAAATGTATTGGCGACGCGTATACATTAGCCATCTCTACACGCATGCGCCTACATCCTACATTTTATGCGGGTACGCTAAAG
TCGTA