Description :
From Genome Similarity Track
Location :
scaffold_55:47034- 48538
Transcript NameFunction/comments
Pl_110968hypothetical protein PHYSODRAFT_472228

Sequence
1504 bases(100 bases per row)
ACCGCACTTGTCTTCCCACCATGCGCTTCATTTGAAAAACCCTCCGACTTGGACATTGTGCGTAAAATCGTAGAGCGTGAAGGATGCATTGAGGCATTGC
AGCAGCTTCTTGGGGCGGCGAAAAGGCCCCAACAACCTCGTATCTCAGGAATCTCCAAAGCGCCGATAGTGTTCCAGAGCGTCATTGATCAGCTACGCTC
AGTGAGTGTGCGGGTTGTCGAGGACATCGAGCAGTGGCAACAACAACAAAAAGCGAAAGCGCAGGCTACGAACTTTAAATGGCGCGGCGTGAACTACTTG
CTCAAGATGACGGCTGACTTGGACTTCCTAGCGTCCTTCAGAGGTGTGGCTCTCCTCCAATCACTTCAGGTACTGCGGCTGATGCAGAACCCGTTTCTTG
CTCTGTTGCACTTAGACCACCCGGCACTGCGCGAAAGTGACCCTGAGTCCGCTGTAGAGTTGTTTGGTAACTGGGTCGGCGATGTCAGTATGCGGCGCGT
ATTCTCTGCGTCAAAGTTGCTACTGCGTGAACGGGAAACAGAAGCTCGGCGTAGGCAGATTCGACTGAATGAACCGACTGAAAACCCTGTTCCGATGAGC
TCTGTTCATTCAACGAACAAGTCTGATGGCGATTGTGCTGCTGCAACACCATTTAAAGCGTCAGAACAACAACAAAGGAGTTCATCAACTAAAGGAAGAG
CGCAATTATCAAACAGAGGCGAAATTTGCACCCCGCTCGGTGCTGTTCCGACGTCGTCTAACCCCCGTGAAGCAGCCATGCGCGAGGATATTGTATTAAG
TCGGGAGCTAATCACCCAAGCAGAACACGAGTTAGGTGCTATGCGAGACGAGCTTGCAGCTCTTCAAGCACGCCTCGAAGACGTCATTCTCCCGGATAAA
CGCCGGCGGTTGAAGACTCGGATCGGCAGTCTTGTCAACGATCTCAAGTTCCGTTCAGGAGACTTGTATCAGCGCAAGAATGAACTCAAACGCAAAGAGG
CCATCTACCGCATGGCTAAAGACCGTTGTCGATCAGGCAATGATTCTCGAGGTAGATCACGCTCTCAATCAGAGTCAGTAGTTACAGCGGAGCCAATGCA
CTGCGGACGAAAAAGAGGAGTGTACTCTTCGCTGTTCGAGACAGCTCTGTTGGAGGATGAACAAGTCCGAAACGATCTCGTGTCGCGCGTAAACGCGTCA
TTGTCCAAAGCGCGAGCAGATGACCATAAGCGTGCCATGGGCTTGGCAACCCCAAGTCGACGACGGCAAAAATCGTCTGAAGAACTGCAAAACCAGCAAG
TTGAAACTTGCGATGAAGAGATGGAGCGGTGGGGAGCTCGCGAAGTACAGAACTTCCTGGACGCACTAGGACTTGACAATGGCAGCTACGGCGCCAACTT
TCGTGCTCAGGGTATCGACGGAAAACTGCTACTCCAGGCAACTGACCGTGATCTTGAAGAGCTGGGAGTCACCATTCGACTTCACCGGATTCGCATCTTG
GGGG