Description :
From Genome Similarity Track
Location :
Scaffold_39:4703- 8751
Transcript NameFunction/comments
Phyag_g982hypothetical protein

Sequence
4048 bases(100 bases per row)
CTGCCTAATCAACTCTACCACGATACACAACATTCAATAGACAGTACCCGCTCTCCTCTCGATGCGCATTATAGTCCACCGCAATCTTGACATGCTGCCT
TGATGTTGATCGTGAAAGCGCGACGTATAACTGGCCATGGGCAAACACTGGTTGTGGTAAGTATACACCAAGCTCTCGTAGCGTCTGTTCTTGAGCCTTG
TTAATAGTCATGGCAAACGCCAACTGAACCGGGAACTGGCGCCGGCGAAGCTCAAATGGAAGACCGGAGTTGTGTGAGATCAATGGGATGCGTGGGATAA
CGACAATGTTGCTGGTGAGGATTCCTGTCAGCACTTTGGCTTCGATGTAGTGGTCGTGCATATGGCGCGCTTGAAGACGTGTTCCATTGCATAGCCCGCT
TTCGCCGTTGATTTTCGGAGTAGTATGATCGGAGCACCAACCTTGAGACGAAGCTTGTGTGGTGGCATCCTTGAGATACTTAGCGAATTCAGAAATTCCT
CAGGGAATATTGATGCATCCGAGCCTTGCGCGTCTTCAACGGTATCGATAGAGACGTATTCCTTGGTCTCGCCTGGCAACGATTCTATCGCTGAATTATT
GAGCTTTAACTCATCGGCATTCAGCTGCGTCAGAATCGCTCTGTCTGCGAAATAGCCATCTTCAAGATACCGCTCCCCGAAGTCATCGTATACGTGATCG
ATAAGGACCTTCGACACTTCCACGCCGTCTAGAGGCGTTAACATCATGTCTTCTTAAATCCTCGTGTAGTCTCTCCCTCTCTCGGAGCATCCTTCATTAC
GtccttcaccaacacgcaATAGAAAGTCAGTAAACGTTTGGGTCTACATCGCGGTTGTTCCATTCACCATGCTATGAACTCTCATGTTGGTCTTGAAACG
GAGGATGTCAAACTTTGCCCACAGCGACGATCGCTTGATACAGCTGTTGACTACTTGGCCGGGCGATCCATGGGGAATCACAGGAAGGATTTGACGTAAA
TCGCctgccagcaacaccacTTTTCCACCGAAGGGTTTATCATTCTTCATGAGATCCCGCAATGTGATATCCACCGCCTGAAAACTGTACTAGATCATAA
GCGGAGCCTCATCCCACACAATCAATATTGTTTGCCTCAGCAATTCCGCATGATCGGAGCCAGCCGTGACATTACAGGTAGACGTAGAGGTTAGGTCCCA
CCCGAGTTGGAACGTATAGTGTGCCGTTCTGCCACCCATTAATTGTGTCGCTGCAATTCCGCTAGAAGCAGCTGCCAACGCGATCTTTCCCTCCAAGCGA
ACGGTGGCTAGAATTGTCTGTAGCAGGAATGACTTTACGGCACCACCGGGACCATCCAGAAAGAATAGCTTCTCCTCAGCATTACCACAGTGGACCGCAC
TGATCATCTTACCATACACCACCCTTTGGTCGTCATTCAAATGAACCGCTTGAGATTTCAGCTATTCCATTGCTGAGTGATCATAAGATCTCTCCGTCTC
GATCAACCAATTTGACGCCGCGTCATTGGAGTGAAGATTACTGAAGTCATGTAGCTTGGGTAGCCTACGGAAGTCTTCAATTTCCTTGTTATTGCTGCGC
AAGCACTGGTCAACTGGTCGAACGGTAAGATAAACACCTCTCGACTCGTGACCGATTGTTGACGGTCTATCTGAAAATCCTCGGACATGTCATTCAGGAA
TGTGTCCCAAAGAGTCTTTGGAGAACTGGGATGGCAATGTACCAAAATAATGGCGAATAGGTGTCGAAGCTGGTTTGGCATCTGATGTTGACTTGCTTCT
TCCATACAACGATGTCAttcatcgtcgctctcaAGTAATCCCcttgcttgagctgcagcttggaacgTCTCATGAATGGTTGCATCAACCGTTCGAAGAT
CCTCAAACGATCTCGGTCCTCTTACGTTGCACAACAGCATTCGAAGATAAAAGCGCTCTGTATCGTTGGGTGAAACAGAGACCATCCGGCCAATCGCCTT
TTCACTGCCTCTCGTTCTGGGCTTCCAATTCTTGCTTTCCTTGACCCAGGTATAGTAGCGTGGAAACTCGTAGTATAGTAGCTCTGTAGCATTGGCATCC
GCAGCACACATTTCGAAAAATATTGTCAGCATTGTAAGGCGCTGGGTTGGAATTCTTTCCGGGTGTTCAGGACCAAATATAGTATAGTTCATTTCCGGTA
GATGAACTGACAACTGGAGCACCGCATGCGACTTCCACTACATTGGATACTTCAACATACGCCAACACGCCTCAGGAGGACAGATATATCGATCACTGAG
AAATTCCTCCACCTCATCGATATCAACCCGTCGAATAGCGTTGTCGGCCACATCAGTAACGGGCGCCTCGACGGAAAACGTTGCACGATCTTGTCCCTTG
TAGATGTATTTGATCGCGTTGGTCATCGAGCAGATCTCAACGTTGATGTGACAGTTATACTTCTCGCACAGGTATGGATTGTGCGGAATCACCCAGCGGT
TGTCATGCTCGACGTTCTTGCCCATGGTTGATAGGCCTTGGTCTCTCCGTCTATACTCTGGGCTTCCACTTTCCTCACGCGTCGTGTCCGTGTGGAAATG
TTTAGGGTAGCCTTTTGAACAGACACCACCCTTCATACACGGAGCTTTAGGGTTGAGCACGGCACATGGTCCATGCATCATGCACTTGGCCACTGTCTCG
TACAATTGCGGATGTGTGTTGGGATCTGGGAGCTCAGCGCACACAAACTTGTCGTAGTCCTCGGgacgtcttgagctcgagtcTTCCGCAAGCTTCACCA
ACATGTGAGCATGTGGTAAGCCTCGTTTCTGGAACTCGATAACGTAGATCAGTGCCTGGACTTTCCCAAAGACTTCGTTCTTAATGATATCATCCTTAAT
GGCCCCACTTTCAGCTTGAACGCTCGAGCAACCAAATCCGGGCGGTCAGCACTGCGTTGGCTCTGGAACAGCGCCTCCTTGATTTCTGGCCATTCTGGAT
TACATGTGATGGTGATGAATAAGTCTGGCTTGCCAATTTCACGTACGATCGCCATGGAGTCGTAATATTGCTTACGCATGTACCGCTCACCACCTATGAA
ACTTGGAGGGAGAAGAACAAACCGCCCGACTTCTCCCAAGTTGCCGTCATGAAGAACAGTGTCAATCACACCACGATAAAGACCTGCACGGAATGCGGGT
TAGTGTTGCTTGATGTAGCGAAGACGTTAGAGTTCTATCTTGACGTACATTTCCACACACCACTGCCGAAAAAGTCGCGAAGGCCGATGAAGAATTGAGT
ACTCATCCTTCCGCGTAAAAAGCTGGTAGACGTAGAAGTCGCGCACTTTCATACGTTTGTTCTTGTAACGCACGACGCCTGGCTTGTATTCCACTTTAGT
TGACCGCCCTTGCTCCCCATACGGAAATAGTAAAGGGAATTCCAACGGGTCGTAAGCTGGATGCAAATCCGATATTCGTTTGAGGCCACCACCTCGGCAG
CTTAAGATGATATCATGTTCCTTGGCCGAATCCTCGTCCACAATAATTGCAGCAACCTCATCAGCGGTGGGTCTGTTGTGGGTTCTTAGATCTGTACCTG
GATCTTCGCGAATCACCAAACGCAGATCCACACCCCGTCGTGTCTTCTCTCCTGCAGTTATAAACCTCATGACACACGGGTTGTAGGCCACTAACATTCG
TTGAAGAGCCTTGACAGTAGGCCGATCCAACTTATCCATGATGCGCATGCGTCTGTCTACCTGATTCTCCATATCTCTATCATAAACGTAAACTTGGGCA
AAACGGGGTTCGCTGCCTGCCACCAGTAGCAGTGTTCCGATTCGATGGCAAATCGTTCCTTGGACTCGCGAAGTGTCTACACCTTGCCGTCCATTTGCGT
AGTTACTATCCACAGCAACGCTGTCTCGTACTGATGCGCCCATTGAAGTAAACGCAAACACGTTGTTGTACGCTCTTATCTGGCGTAGTAGGTCAGGAGT
CGAAACGAACTTCTCGAGAAAACTTGGCGGGTCATTTGAGGGTGCAAG