Description :
From Genome Similarity Track
Location :
Scaffold_1972:4702- 5822
Transcript NameFunction/comments
Phyta_totarag13944ABC transporter lipid export ABCA family

Sequence
1120 bases(100 bases per row)
GCGGTGAGTGCTTTGGCTTCCTTGGGATCAATGGTGCTGGCAAGACGACAACCATGAAAATGCTGACAGGCGATGAGCTTCCAACGCACGGCACTGCAAC
GCTGGGGGGCTTTGACATCCTCAcacaacaacttgaagtgcgTCGTCAGATCGGATACTGCCCACAGTTTGACGCCTTATTTGACCTGCTAACGGTTCGC
GAGCACCTGGAGCTGTTCGCGTCGATCAAGGGTGTGTCTCGATCTGAGCTGAACGAAGTTGTGGAGGACAAGATCAACCAGCTGAACCTGAGAGACTTCG
AGAACAAGCTCGCCGACAGTCTGAGTGGCGGCAATAAGCGCAAACTGTCGGTGGCAATTGCCATGATCGGCAACCCACGGATTATTTTCCTGGATGAGCC
GTCGACCGGTATGGACCCTGTGTCGCGTCGCTTCATGTGGGATGTCATTGCCGACATTTCGACTCGCGGCAAGAATTCTACAATTGTGCTGACAACGCAC
AGTATGGAAGAGTCGGAGGCTCTGTGCTCTCGCGTGGGGATTATGGTTGGTGGCCGTCTGCGTTGTTTGGGCAGCGTCCAGCACTTGAAGTCTCGTTTCG
GCGATGGCCTGGTCTTCGACGTGAAGCTCGCCAACCCTTCGCAGGAAGAGTTGGATGACCTAGTGCAGCGACATTTCGGAGGCGCTGAAGAGACCATCAC
CCGCGCGGATTTGGAGGATAAGTGCAGAGCGTTTGGAGATCAGGAGTTGGCTCAGCGAGTTGCGGCCTCACACCCGACAGGATACAGCCTCGCAGCCGTA
TTGGAGCGTGATGGATACATTCGAGCGGAGGCCTTCCTTTCGTGGTGCTTGGAGGAGACTCGTTTCGATGCATTGCTCAACTTTCTCAGCTACTCCTTCA
GCCACGGCAGCGTAACGGTCATGGAGCGTCAAAACGACTTCTGCCGGTTCAAACTGCGTGGCTCGAACGAGGAGCTTCGACTGTCAAAGGTGTTCGCGCT
CGTAGAAGACATCAGGGAGAAGATGCACATCCGCGAGTACAGCGTCTCGCAGACctcgctggagcagatctTCAACTTCTTTGCCTCCCAGCAGGCCGAG
GAGCAGGGCGTGGCTCGTGG