Description :
From Genome Similarity Track
Location :
contig_24:470186- 471581
Transcript NameFunction/comments
g5731.t1hypothetical protein

Sequence
1395 bases(100 bases per row)
GACCACCTTCCGATGATCGTGGAACCCACAGGAGAAGAGAACCACCACCTGAACCTGGAAGACCCATTAGCCCAGGACGCCATCGGTCCAGATACATCGT
CTTGTCTTGCAACTCGGAAACGGTAGACTCCCAGGTCACTGTTTCGCCGGCACCAACATCTACCTCCGCGTAGTCGTCACCACCAGAGTGTACTACTACC
GTCACGTCCTCCTTGTCCGTGCTTTCGAAGATAAGACGCACGACGCCGTCACCCTTCTTCGTCCACCACCCGTAGCTGCCTGCAAAAGCTTGGTCTACCG
TCGAAAGCCCCAGAGCGTCGTACAGCGTGCCATCGTCGACCTCACCGATGAACGAAGTTGGTCCGCAAATCGGCTGCACGAACTGAGACGCCATCCACAC
GACGCCGGTCGGGTCCAAACCACCGATTACTGTCAACCCCAAGTTCGTCACCTCCAACATGTATTCGTCTTCCTTCACGGATTCTCCCATGTCCGTCGTT
GCCGTGTCTACCAATTGTTGGATAATCACTTCCACCGTCTTCCGCAGCAAGTCGCGCGTCTCAAACGCAGCGTCTTCCGTCTTGTTCACCAACATTTCCT
TCATACAGTTGTTGGTGACCGTGGGAATATCATGCAGCACAAGTGGCGACTTGCTTATCGTCACTCGAATGTCATCGACGGCGGCATTCGGGGTTTTGTT
CCGAACATCGCTGACCGCAAAAATGACGCGGTCAGTGAGCTGTTTGAGCTCGAAGCCGCAAGATGTGTTGGCCTTGATGAAGTCCTCCAGTTCAGTTGGA
CTTGTGTCGGGAGATTTGATCGCGCTGGTGTTGGTCAGCATTTTAATGACATTGTCTGCGGACGAGATGATCTCTTCGCCGTTGATAATAGCTTGTTTGA
CGATGTTTTCCACGATCACCATCACAATACCTGTCCATTGCAACTTCGGTGGAACCTTCATCCCAAGACAAGAGTACACCGCAACGGGCAAGTCCACAGC
GATAACATCAGTCTGGTAAGCCACCGCCAGCAGTTTCTCGACGTCGCCTTGAGGTGCTGTCGTCTGTGTGAAGCGTAGGTAGAAGATGAGCGACCTGATG
ATCGAGACAACGGCCGAAGCGCAGAGATACATCTTCTTCATCGTACTGAAGGTGTTGTATGCAGCTTGAGTTGGCCGAACAATCCCGCTGTCGCCGCGTT
AAACGCTACGGCGACAACGGACACCACTTTCTGAGCGATGTTCAGCGCACAGTCATCGTTTTGTGGGATACACTCCAAGCTGCACTCAACTGGGTACGCC
ATCGGACACTGTGTGATGCAGTCGTCGTCGTCTTTGCCGTAACCCAACGGGCACATGTTCTTGCTGTCGAAAGCCACCGTTTTCCGATAGCACGC