Description :
From Genome Similarity Track
Location :
Scaffold_5:470169- 472083
Transcript NameFunction/comments
Phyci_209286Hypothetical protein

Sequence
1914 bases(100 bases per row)
TAGATCGAGCTTCAGATTGAGCGATCCGGCGAGCTGGTGACGCACAAAGTACAGGTCCAAGATCTGCACTCGGTTACCCCGTCACGTTTTATTGAGATTG
GCGGGGCTGTGATCAATCCACTGTCGTATCAACAAGCCCGGAATCATGCCATGAGCCCTGGAGCGCCGTATGTAGCGGACCCGGGTTACTTTCTTCAACG
CTCACGCATTGGCCGTGGCGCTATCATCCACTCGGTGAATGGGATCAAGACACCCGACCTCAAGACTCTCAAGAACTACCTGAGGCAGTGTAAAGACCGG
GATCGTATTGTGGTCAAATTCTCGAAGTTGACGGACAAGTCGGAGAAGGTTGAGGTTGTGCATGTGGACCGCAGGTGGTTTCCATTCTGCGAGTATGTGC
GCGATGACAAGCTCGGCACATGGCACTGTGAGCACTTTGTACCACCAAGTGAAAGCGCTGGTGGAAATGTTCAGTCTTCCGGTCAAAAGGAGCCGATTGG
CTCGACAACGACCCTGCCTGGTAAAAATCCGGTGGAGAACAAGCTTGCGCGGTCGCTGGTAACAGTTGACTTTGACCGCCCGTTTAGCGTGAACAGCCTG
TCAACATCGAACTACCGTGGGACGGGGCTTGTAATCGATGCGGAAAAGGGACTTGTGGTGGTGGATCGTAACACCGTCACTGACTCAATGGGCGATGCCA
TGGTCACCTTCGCCAGCACTATCATGGTTCCAGCTCACGTGGTATTTGTTCATCCAGTGCATAACTTCGCCATTGTACAGTACGATCCGAAACTCATTGG
CTCAACTCCGATAGAAAGCTGCCAAGTCGCATCTAAGCCATTGGTGCCATCTGATCCGGTGTGGCTTGTGGGTCTCATGAGCAGTGTGGGGCGCAGTGGT
CACTCGGACCTTGTGTCTCGGGAGACCATTGTATCCGGCGTCAAGTGGATTGGATTGCCTATGCCGAATCCTCCACGGTACCAAGAGCATAATCTGGAAA
TGGTGGCTTTGCAGGATGTCGTTGGGACCGAAGGTGGCGTTGTGTGCAGTGATAAGGGTGAGGTGAGTGCTTTCTGGGCTTCGTTCTCGTTCCAGCAACA
ACGCCGCAGCTCGAAGGTGGAAAGTCAGTTTAATCGTGGCATCCCGATGGAGCTGATAATGGAAAGCGCGGCGCCGCTTATGCGGGGGGTGACACCCAAA
ATCTACGATCTGGGTGTAGACTTCGAACACTTGAGCTTGGCAAAGGCTCGGGAACTGGGACTCGGCCAGGCTCTAGCTGAGATTTTGGAAAAGGATGCCC
CAGACCGCAGAACTATCTTGAGTGTTGCGCGTCGGTGGGGTGGCACGGAAGCACAGGACGTGCTGAAGAACGGTGACATTTTGGTGGCTGTTGACGGCAA
GATCGTGACAAGCTTTCGCGAAGTAGAGCGTTGCACGCAGAAACCAGAAGTCCAGCTTACAATTGTTCGAGATGGACGCGAGATGCAACTGGATGTTAAA
ACACTTTTCATGGAGCGCACGGAGATCAATCGCATCGTGTTCTGGCAGGGCTTGCTTCTGCAGGCACCGCCACTCTCTGTATCAGCGCAGCGCAGCATCT
CGCTGGAGGACGGTATCTATGTGTCCTGTCGGTACTCGGGCTCGCCCGCTGCTCGCTACGGACCGCCACCCACGAGCCGCATTAAGGAGATCGATGGTAT
CAAGATCTCAAGTATCGATGATTTCCTGCGCGTCGTCACTGCGAAGTCGGAAAATGATTCGGTGCGCATCAAGTACACGGATTTGAGTGGCAAGGATCGT
CTCAGCACTCTCAAGCTTGAGCCGAAGTACTGGCCCACCAGCGAGCTGGTAAACGAGGGAGGCGAATGGCATCGACACCAGCACTAAAACAGCTGCGTTT
GGGTCACTGTATGC