Description :
From Genome Similarity Track
Location :
Scaffold_1130:4701- 6197
Transcript NameFunction/comments
Phyag_g9604conserved hypothetical protein

Sequence
1496 bases(100 bases per row)
GGCGGCACACTGCGCGACTACCAGCTGGAGGGCATTCGATGGCTCTGTAACTTGTTTGAAAACGGGTTGAACGGCATTCTAGCAGATGAAATGGGTCTCG
GTAAGACAATTCAGGTGATCGGTCTGTTGGCTCACCTTAAAGCGCTCGGCGTGCGTGGTCCTCACCTTATTGTGGCCCCGCTGTCGACGCTGATGAACTG
GGCCACGGAGTTCCGCAAATGGGCTCCGAGTATGCCAGTGGTGATTTACCACGGTACGAAACAGGAACGAAGGGAGATCCGCAAACATGCACTCAACAGC
AAGAGGAGGAACGATGTGAATTTCCCGGTGGTCATTTCATCGTACGAGGTGATGTTGGCAGATACGAAATCGTTTGCAAGCGCGGGATTTGTGTGGAAGT
ACATGGTTATCGATGAAGGCCACCGACTGAAGAACATGGACTGCAAACTCGTGCGTGAGCTCAAGCGAGGACGCTCGGAGAACCGATTGCTGCTTACAGg
cacgccgctgcagaaTAACCTGACCGAGCtgtggtcgctgctgaaTTTCATTCTGCCGGATGTGTTTGATGACCTTGAACTCTTTGAGAGTTGGTTCTCG
TTTACACCTGACGCTGtttccactgctgcagcggcgaaTGAGTCGGTAGCTGCGCAAGATGTGCTGCAGGGTGAGAAGAAACTCGAGGTTATTGCCAAGT
TGCACGAGATCTTGCGaccttttcttcttcgccgcctGAAGGGGGATGTCGTGGAAGAGATGGTCTCAAAGACGGAGATTTTCGTTTACTGCTCCATGAC
GCCGATGCAACGCGAATACTACCATATGATTCGTAATGGCACGCTTGCAAAGGCTATGGAAGAGAAGTATGGCAAGTTCCAAGCACAACAAGCGTTCAAG
ACGACGACCTTACGAAACAAAATGATTCAAATGCGCAAGTGTTGTCTTCACCCGTACCTCTTCGACGAGCCCTTGACAGCAAGCGGAAGTGTAGTTACGG
ATGAGAACATTGTGGAGACGTCAGGCAAACTAAAGGTACTGGACCGGATGCTGCGggagctcaagcgcaagggCCACAAAGTGCTCATTTTCAGTCAGAT
GACACGGATATTGGACATCCTGGAGGACTACCTTCTCATGCGGGATTACAGCTACTGCAGACTGGATGGCAGTACTAAGCTAAGCGATCGTGTCGACcag
atggagaagttcaACAAGGTATCTGCTGGTTCAGCTTCGGCAAACGACGACGATAACGTCTTCATTTTCATGCTCTCAACGCGTGCTGGTGGTCTTGGTA
TTAACCTGATCGCAGCCGACACGGTCATTTTCTATGATTCGGACTGGAACCCACAACAAGACAACCAAGCCATGGATCGTTGCCACAGAATTGGTCAAAA
GAACGAGATTATCGTGTATCGCCTTGTGACCGAGAACTCTTTCGAAGATCGTATGACCCAGAGAGCTTTCGAAAAGCGTAAACTGGAGCGCGTTGT