Description :
From Genome Similarity Track
Location :
contig_24:470049- 471734
Transcript NameFunction/comments
g4612.t1hypothetical protein

Sequence
1685 bases(100 bases per row)
CGTCACCTCCAACATGTATTCGTCTTCCTTCACGGATTCTCCATGTCCGTCGTTGCCGTGTCTACCAATTGTTGGATAATCACTTCCACCGTCTTCCGCA
GCAAGTCGCGCGTCTCAAACGCAGCGTCTTCCGTCTTGTTCACCAACATTTCCTTCATACAGTTGTTGGTGACCGTGGGAATATCATGCAGCACAAGTGG
CGACTTGCTTATCGTCACTCGAATGTCATCGACGGCGGCATTCGGGGTTTTGTTCCGAACATCGCTGACCGCAAAAATGACGCGGTCAGTGAGCTGTTTG
AGCTCGAAGCCGCAAGATGTGTTGGCCTTGATGAAGTCCTCCAGTTCAGTTGGACTTGTGTCGGGAGATTTGATCGCGCTGGTGTTGGTCAGCATTTTAA
TGACATTGTCTGCGGACGAGATGATCTCTTCGCCGTTGATAATAGCTTGTTTGACGATGTTTTCCACGATCACCATCACAATACCTGTCCATTGCAACTT
CGGTGGAACCTTCATCCCAAGACAAGAGTACACCGCAACGGGCAAGTCCACAGCGATAACATCAGTCTGGTAAGCCACCGCCAGCAGTTTCTCGACGTCG
CCTTGAGGTGCTGTCGTCTGTGTGAAGCGTAGGTAGAAGATGAGCGACCTGATGATCGAGACAACGGCCGAAGCGCAGAGATACATCTTCTTCATCGTAC
TGAAGGTGTTGTATGCAGCTTGAGTTGGCCGAACAATCCCGCTGTCGCCGCGTTAAACGCTACGGCGACAACGGACACCACTTTCTGAGCGATGTTCAGC
GCACAGTCATCGTTTTGTGGGATACACTCCAAGCTGCACTCAACTGGGTACGCCATCGGACACTGTGTGATGCAGTCGTCGTCGTCTTTGCCGTAACCCA
ACGGGCACATGTTCTTGCTGTCGAAAGCCACCGTTTTCCGATAGCACGCCGTATCCTTGGAATTTCCAATGGTAGGGCCCACCCAGTTGCGGATAGTGTT
GCCGTACCAAGCCGTACCCATGGTATCTGTAAGCAGAGCTGGCACCGCTGATATCCTCGTCCAGATAGCTCCGAGTTGGTCGACTTCACCCTCTGCACGG
CCATAGAAGCCGCCAAGCCGGAAGCCGTCAGGGGCAGTTTCCGTCGCACTCTGTTCTGTCTTCGTTCCCGCGGCAACAGAGTTTCCTTCGCTCGTAATGA
GGTTTACAAAGGCTACATGTGTGCGTCCGCTCTTCTTTCCCCAGTGAATCTCCATTGAATTGATGTACTCGCCAGGAGCGAGAGCGAGGGTGTTCTCAGT
TCCGCCTGAGCCGCCGTGACCCCAGGTCAATTCCGCCGGCGTCGCGACCTGCAGTGTGACTGCATCAACGCGCTTGCTACCGCGAAGAGTGACGGAGCTA
AGCGTCTGCCCTAGTATAAGCTCCGACATGTCAGAGAACGCGACACCATGAGGACCTCCATAAACTGCGCTCAGCTGGATATCTTCATCTCCACTAGTCG
GCGAAGCTGTTTCTGCGACTGCTTCAATGCTGGTCCACACCACACCGATCAGATCAATTTCGTCGCCGGACCGACCAAAGAACCCGCCAAGTTGATAGCC
TTCCGGCGCAGTCACCGTGCCTTTTTCGTCGGTCGGGGTCCCCGCAGAAACCGTGTTACCCGCGCTCGTATCGAATTTGAGATAG