Description :
From Genome Similarity Track
Location :
Scaffold_253:4700- 6070
Transcript NameFunction/comments
Phypl_g6002HAE (highly acidic elicitin) 20
Phypl_g6003conserved hypothetical protein

Sequence
1370 bases(100 bases per row)
gccgccgctgctgccgccctcGTTGGATCTGCCTCCGCCACGACCTGCACGTCCACACAATCCACAGCCGCCTATGTCACGCTGGTGACCCTGCTCACCA
AGTCGTACTTCTCGACGTGCGCCAGCGACTCCGGCTACTCCATGctgacggccacggcgctgccCACCACCGCCCAGTACGAGCTCATGtgcgcgtcgac
ggcgtgTCAGGAGATGATCGCGGAGATCATCACGCTGAGCCCGCCCGACTGCGACCTGACGGTGCCCACGAGCGGTCTCGTGATTGACGTCTACACGTAC
GCGAACGAATTCGCGGCGACGTGTgcttcgctgtcgtcgtcggcttAAGTCTTGGCGAGCGAGTGACTGTCGTTGTACCCAAAACTTGAAGCGCTACGGT
TTTTGACTAGCGCTCCGGTAGCCTTAACAGAAACTACGGACGGTTCTTATTGAAAGCCTCGCTCGCATTGCTGCCAGAACGAGCTTTTGAATAAATTCTT
TTTGCGACTTTACTCTTTAGTGTTGTGTGTATTTTGGTATCGGCTAGACTGGAACTTGCGTTGAAGTGCTACTGAAAGCCCTGACGAAAAAGCTGTAAGC
TTAGTGACTATCAAACAATGAGCGTTGAGATTCGAACACAGCCTCGATCTGCCTACGCCTTCAAAAGCTCGGGTTTCCATCGCGCATTGACATAGCGAGG
TCAAGTGGGGCCGAGGCTACTACCACCGCCATTATCCTCGTACCTAACATCAGTTTTGGGCAACACGGTGGGGCCATGGCCACTATAGGCGACGACAAAC
CTTGGGcggtgaagctgaagcggaaACTGCTCCATGAGATGGGTCCCTTCGGCGGCGAGTCTACAGTAGCGATGTGTTTCAAAAGGAACGCCCAAGTCAG
CTTCACTGGTAAGTCAACTTACGTCAAGTTGTACGGGGGCAAAGATACAAGCTCGCGTAGCGCGTGGCAAAGGGTTTTGATGGTGCTCTATAGCGAGGCG
AGGAAATGGGATCGACTCGTTGGGACGCTGCTGGTAGTTTTCTATTGGCAAGCACACTCGGCCAGGGACGCCCAGAGACGCCGGCAGATCGAATCACTCC
ACACAACGCAGACACTTTGGCTGTTCACGGTGGACCAAGAGTTTGAGGCATCAAGCTAATGATCGATCGAGTAAACCCTTGCAAACCTTCCAGAttcgac
atcgtcgtcaagGAGGGCTCTGCAGCCCCATCCAGACCTCTCACCCTCTCCATTTTATTACTCGTACAACAGGCTTCCTCCATCCGTCTAGCCTCTAGAG
AGCTCCCAGGCCGACACCTTCGAAGCCGCCGCTCGTGATCTCCatggcctccgccgccgccgactcgTCG