Description :
From Genome Similarity Track
Location :
Scaffold_2778:470- 2604
Sequence
2134 bases(100 bases per row)
ATATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGCCTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATG
ACCTTGCGAGCGCGTAAAATATCGGCGTTCGTCTGCGCACTCGGACATTTCGAGTGGTTACGCATCCCCTTCGGGCTAAAGAACGCGCCGATGATCTATC
AGCGTATGATTGACAACGCACTCTGGGGGTTCGTTCAGCCTAAAGGAGGTTGGTTTGAATACTCGGAAAAGATGCGTTTAGCTGAAAAACAGGCCAAGGA
ACGTCGTGGGCCAAGCGCCGAGGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCTGTAGAAACCGACCCTGTACTACAACTCGTCAACAGC
CCCGTCGCTGACATGTTTACGAACGGGGAGCCAGACGAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCG
AGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTAGCAAGATTCGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACC
CAAGGTGGACTTTTTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAG
AAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGAAG
ACTTTGTCGTTGAAGGTGGCCTTTCTGTGGCACGTCATTCCTTCGAAAGATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTC
GAAAGAAGTTCACGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACACTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGCTCCTCGGT
CGGGTGCTCAAGGAGGCCGAGATGAACTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAA
AGACGCTACATGTCTATACACGATTCTCGACGTTAGAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTATCGCA
GTGGCACCTTAAGGTGCAGCGTGTGAAGGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAGGACTCGCTC
GCGCCGGTGGCACCTCCAAACAAGGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAGGCTTTCCCGTAATTACAGCGGATTCGTCATGT
CTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAA
CGCTTACCTCTCGGCCACCACTGTGAATGAAGCAGAGTACACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATC
GTTGGGGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGACAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGG
CCAAGCTTCGATCAGATAAATATCTTCACGCTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCACTGGAATCAAAGGTCAGTCGGGT
AATCTTGGCTGAAACTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACGA
GGAGCAGAGCGTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATT
ATGGTAATATAGCAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGGATGTCTCAAAAGCTCAAGAAGA
GCATGAAGAACGACGAGAGACGTCCACCGAAGAT