Description :
From Genome Similarity Track
Location :
Scaffold_184:47- 3865
Transcript NameFunction/comments
Physo_124888hypothetical protein

Sequence
3818 bases(100 bases per row)
GAGCTCGCTCGGCGACTTATCGCCCAACGACTGCACGGGCGTGTGGTTCAAGTTGCCTTGAACAAGAGGTAGTAAGTAGACCCACTCACGAGTGTCCAGC
TTGTACTCCATAAGCAGGACGCGAACAACTTGCAGTACATCGCGGTTCAGACGCTCAATTGTACCGTTAATCCACGGCGCGTAAGCTACCACAAGACTCT
GTTCAATGTCCAGCGTTTCGCACACTTGGCGGATCACCTCACACTTGAAGTGGCTGCCCTGGTCTGATACGAGCACAGAGGGGGCGCCAAAGCGCTCCCA
CCAATCCAGCATTGCACTCGCAGCAACGGTACTCGTAGGTGAATCGCACGCTACAAGCTCACAAAAGTGAGTGAGGCCGTCTTTCAGTACCAACACATAC
TTGTGACACGAGGCGACTTGAAATTTTGGAGAGTGTCCGCGCAGCTGGCCCCGGTGCCGATCCAGGGAGAGCGAGGAAAGAAAGGTCGATTCAGGATGGT
GTACCTGTGGAACGCCCGAGCATGATGGAGGAGATGTGGAGTATCGATACCTGGTCGCGTTTGACCTCAACTGGCCGGAGGTGCGCAGCACCCAGTCCGG
CCCCGACCTAGTCTGACGAAGGGAGACCGTGAACGTATCCCCGAGAGCTACCCTTCTTGACGAGGCCAAGGCATCCCAAGGTACTTCGAATCCCCGGCAG
CCCGAGGGTGAAGCTACTCAAGTGTACCAAGCCATCGACACCCTGAACTTTACCACCACCGTGTTGAAGACGAACATCCAGGATACTGCGACTACGAAGA
CCCCGAGTGTGACCCGACAATGAGTTGAGGACCTCAAGCAGCGAGACCAAGTGGACACTGAAGCTCGTGGAGTCGACGGCAGCCTGGATGGACAACCGAC
AGCTCGAATGGAATGCAACTACCCCGAATGGCGGATGGCCATCCTGAATGGACAACGCCCGGAGTGCCCAAGTGCCGATCATCCTGAATGGACCAACACT
GCCCTGAATGGAGAAGCCCCAAGCCACCGTTGTTATCTGCCAATGGACCGACGCCCAGGAACGTGCCAAGTCAGCGAAGTCAGCGACCAAGGTGCCAGTT
CCGAGCGTGACTTGGTTTCACTATGGAGAGTGAGCCAGTCTGAGTTCGATGTGTCAGCAGTGCAGCAGATCCCTAGGTCAGGCACCTGAGTCCCTCCGAC
ATCAAGTGATCGCGACGCGACGCCGGCAAGCCAAGAAACCCGAACAAGTGTATGAAGATATGAGCAGAGGAGACCGCGTGAAGAATCCAGCGGCCCTCAA
GGTAACAAGACCATACGAAGAAGAAGAGAGAGATACAAAAGAGAAGAGAGATAGCCAAAGAGAGAGAGAAGAGGATAAAGATCAACAGAGTTTGTTTTGC
GTTCAAGTGCACAAGTGCCTGGTTCGCAATTCGCCTAAGGACAGCCGCCGCCCACGGGAGAGTGTACCGCCTAGGAGCCCACGAGAGGGTGTACCATTCG
GAGCCCCGCTGCGAGCGTTGAGTAACGCCTGGTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATATTCAGCAGCTGCGGCAGCCCTAGCTTGTAAACGGGTCATGGCCAT
TTTCGCTCCCCAACTCGTACGCCAATCCCGCAACCCAAGTCGCTTACCAATACGTCTGTACGCGGCACGCGGCGGTGGGGGCCTCCTCCTACTGCAGGTA
AGCTTAGCCGATATTTATTATGATGTTCCGTACATTTTTGCTGTTTTTAGCTAATGAATTCTTGTTTTTTTCGAGCGGGCTCGTTGTGCTCCCCTGTAAA
ATCGGATCATGGAAGAGCGCCCAAATCCCAACGAGCGCGCTCGCAGGCTTTTTGCTGCTCGCGCTCGTTCCCGCGAGCAGTGCTCCTGCTCAGCTCGTGG
GATGCTTGAAATACCCGGTCCGAGTATTCAGATATCTTGGTTACCATGTGCTCATTGTTCGAATACTTGTTAGTCCTGCGCTGGTTCAAACGTACCAAAT
TCTGGTAGCTTGAGCATTTGCTCCATAGTTAGCTATCATCATGCTTGAGTACACAAAGAATGTGACGCTGCGTCAATGGTTTGCCGGATCAACCTGATAT
TCATAATGACGCTAACAAAATGGCCACAAGCTAGCTAACGATTGGCCAAAAATACTTGATATACGTAATCATTTCGTACTTAATGAGATCTTAATATATC
AAACTAGGGCTCCGCGTAGGCTGGGATAGGAGAATTTTGGTATAAACCCCTTCTTTTATTTTTTTATTATATTTTCTTATTAGCTACGGTCATCTCCTGC
GCCTGCTTCGCAGCCGCAGCATCTGCCCGGAAATTTGACAGTTCAAACTGTCTACCGGCAATGCTGTACAAAATTATGAATGCGAATCTTGGTTGAGATC
TGTTTGGAGCTTGTAGAA