Description :
From Genome Similarity Track
Location :
Scaffold_3074:47- 2160
Transcript NameFunction/comments
Phypl_g15597reverse transcriptase

Sequence
2113 bases(100 bases per row)
GTTCCAGTTCCGGCGTACGTGGAAGAGTTCATGGCGCGGCCAAGCCTGTAATGCGTTCCGACCTCGCTGTCGCAACAATTTCAGGCCTGGTGACTTACAG
TCCATCTTCTCACGCATCTGCCGGATGACGAGGTTCGAGTCTCCACAGGCGACCAGTCGTGCGACTTCTAGCCCTTCGAGCAGCGAACACCCCAGAAGCA
AACCTCGATACTCCGCCTCGTTGACCGTGAGGTCAGATGCGTAGCCCGACGCAGCTTGGACTATCTCCCAACCCGGCAGTTTCCAGACAACCGCGCTGAA
CGATCCGCCTTCGCGTTTGACATTGGCTGATccgtcgaagctgacgacatgcagctcttcgtccgaTCACACCGTTGGGATCGGGATGACTGTGATTCGC
GATGGGCGTCTACGTAGAGCGatctcttccagcgccgtgtcgaCGAACGCCCTGCGTGACACTCGCTGCCAGCGTTCCCAGGATATCTTCCTCTCCCTTC
ATGGACTGGAATATATCCAGTCTCCACGGTGAGAGTATCGCGGCCCACTGCGACAGTCGGCCTTGTAGCCCTTTAGATCGGAAAAGCCACGCCAACGTCG
TATGCCGCGTCAGGCCACGGATCGCCCTTCCGGCCAACATCGTGAAGCAGTCGTTCAAGACGCGCAACAGAGCCAGGACCTCCTTTTCGGCGACGTCATA
GTTCAGCTCGTTGGGCTTGAGTGTGCGGCCGGTGAACTTCACTGGCTTGCACACACCGTCATGATCTTGCGCGAGTACCGCGGAGATCGCCCAGTCACTG
GCGTACACGACGACCACCGGTTCTTGGTCTGGATCGTAGTGCTTCAGCATCGGCGTATTGGCAatcttggccttcagcgtctcgaagGCACGTAGAGCGT
GTATTCACTTCTCCTGGCTGTGAACTTCCGGTCGGGTGGCGTACATTTCGAAGTCAAGCTCCGTGAGGGAGTACAGTGCAGTCGCGTAGACCGCAAACTC
CGCGATGAACCGGTGGTAGTAGTTCAGGCTGCCTAGGAACGATTGCAGACCCTTGAGCGTGCGCGGGAACTCCAACGCCGCGAGCGAGTCCAGATTCTTC
GGTTTCGCTTCAATTCCGGCTTCAGAGACCTTGTGGCCCAGGTAGTCGACTCGAGACATACCCCACTCACTCTTCTCCACACTGATGGACAGATGCCATT
GTTCGCAGACGTCCAGCAGTCGCTCGACCTTCGTGCACAAATCGTCCCATGACGTACCGCCGATtaggatgtcgtcgatgtacGATCTCCGACCTAGGAC
GGAGTGGATCCCTGGGGGTTCCGGTTCTCCCTCATCGAAGACGTTCCGAGTATCGCGGTCGGGCGACAGACTCACGAATCCGTAGAGCGCGTTGTCGATC
AGTCTTTGATAGATCTGCGGCGCGTTGCACAGGCCAAATGACATGCGCAGCCACTCAAAGAGGCCGCGCGGGGTAATGAACGCGGAGGTGAGCTGGGCTC
GAGCCGTCATGGGGACGACCCAGAAACCGCTGGCCATGTCGAGAGAAAAGTACCACAGGTACTTGTCCAAAtcctccagcaagtcgttCACGAGCGGCAT
CGGGTAAACCATCAGTTGCGTCAGTCCGTTCACTAGTCGGTAATCGATGCAGAGTCGTATGTCAATCCCGTTCTTCTTTACGATCACGACAATTGGTGAC
ACccacggcgacgtggacagTCTGATCATGCCAGCACTGAGCAAGCCCTTGAGCAAGTCAGATACCTTTTCCTTAAAGCAGGGCGGGATCTTGCGGACGC
GTTGTGCTATGGGCTTCGCGTCGCCCACATCTATATCGCAGACGACTCCCACGGCCGCGGGCGGCNATAAGCCATTTTCGTCGCCTCCAGATAACCTGTC
GTaggcgctcttcttgctgtgcgGCATCCTCGGGTGTGTCCCCGGTCGGCCTTCCCACCTTTAGATCCCCGATCCGCACTTCTGCCGTCAGCGAGATCTC
TGGCAACACCGCCAGCTCTGCTTCCAGTTCTTCCGCGAAGAGGTCCGATCCTTCGTGAATGAGgcccgcgtcgtccgcgtcagTTTCGTTCGTCGGCTCC
TGGTTCAGGGGAC