Description :
From Genome Similarity Track
Location :
Scaffold_1525:47- 1678
Sequence
1631 bases(100 bases per row)
ACACAGTACTTCGAGCCCGGTTTGAGCTTTAATTCATGTCGAGCGCCTTTATCCTTAGGCCATTCGCATGGTACTGATTCAGGGAACACGTCCTTGAGTT
CGATCAAATCCTTATATAGAGGATTTACCTGAAGCGACTCCCAAGATTGGGACGTGTATCGCTCAATACGAGTCTTCTCATCGAGGACACTTTCGCCAGT
CGATGAGCTGCTGAGAATCCGTTCGTTCTCGGCAAATATTACTGCCGACCGAATGTCAGTCACGTACTCGTCCTCCATCACGAGTACACAGATCTGCTTG
ACCTTGCCACTACGCAGATCTCACAAGAACCGTTTCGGTTCTAAAGTTGGCAATTGAGTGATCTCCGAAGGCAATTGAGTGATCTCCGAAGTCAACTTCG
GAGGTGCGACCAGATCAAGTGTATGAGCGCCTACACTTGACCCGTCATTAACCAAGACATTCAATGTCTCGGTTTCTTCCTGGGAACCCTTTTACTCAAG
TATGTGGAGACTTACTCCCTCGACGTCTTCTAGCTGTGGCAGCGCAACCACAGCTAGGTCCTCTACGATCGAATCTCCAGCCGATCTAGGATCATCGTGT
TGCCCTTTGTGGGCAACTGGTTTATTCTTACTTAGATGTCGCCCGCTAGGCGTACACCCATGTACCGATCCACTCGACTTGTTCGAGTGGTGGAATTTCA
GCGCTGCCTGTGCATCCGCACAGCCGTCGGCAGCTTCCTCCACAATGTGATTGGTCGTCACACTGTGATCTCGTGCAGTCGTACTAACGACCTTACCGCA
AGTGAGGCCATCGCACTCGCTCACAGTACATCCACACGCTTGTGGACGCTCCAAGACGTTCATCAGATGGTCATCTGATGAACAAGTGGCGGGCATCTTC
ACGGTTCGATGCTGCCATCTGACCCTTGGCTCGAACCTTCTGAGCCAGGGTACCCTAGGATGACATCAAATTTGTCATCCAAATCAAGTACGATGAAATC
ATCATTGTACTGCAAATCTTCTAACGTGTAGTGAAATTCCACTACACGTTTCATCCCTGCTATAGATGCGCCTGTTGCGAGGCGCACCGTCAGCCTCGTA
GGAGAAGTAACGTGCTCAACGAACTTGAGCCTACAATCCTCTAGAGACTGGCGACAAACAAAGTTGTTCGACACCCCAAATTCAACTAAGGCACGAAGTG
ACAAACCTTTTTTCACTTCTAAATTCAAGGTGACGAGGGGTACCTCATCAAAAAGTGCAGAGACACACAAGGATTGTGAGTCTGGAGCAACTTTCATCAA
TAGATTTGCAAATTCTATTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCTCTACTGGCCCCGACCGTTTTTTGACGGTCCGCTTCGGTGTTGTGCCTTCG
CAACAGCGTCGGACCCGCGTCCGTTGCCCTTCTCGGCAGACGGTCGATCACTTCGCTCAGTGTTACGAGACACTGGGCGTGAAGCACTACACTCGTTGGC
GTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGCAATCGCTTCCTGCTTGAAGAGCGAGGTCTCTAGCTCTCGATACCGCAGAGGTCCATTGGTTCT
GTACCTCCCGCCTCTACTCATGTCAAAGGAC