Description :
From Genome Similarity Track
Location :
Scaffold_1569:47- 1235
Sequence
1188 bases(100 bases per row)
GGAAGTCGACTTAAAAATgattaaccctttcgtgtCAGAAgggcgcaaaactcgcccttTAACGTCATTCGCATTTCACGGTACAAAATCGATgtctaaa
agggcgcataATGCGCCCTTGGGGCATTTTATGTCATGTGTCTCACCGTGGTATGTTTTATCCAATCATTGCCATACACTCCATGGGGTTGGTGCTGCTa
atgcgcagcagctggggCCCGTCAGCTCATTACGTACGAAAATGGCACACTATGAACGAAAATTAAACTAACAAGCCGTAAGATATCTTGCCACGTCCGC
AGCATCACGTAAAGATAGTCATTCCCCCACCATCCATTTTTGAATAATACAAATTTCAAGATATATGCATCCACGCGTCATTCTCGGACAGTTTCAGCCA
TTTACCGTCTCCATGAGGACTAGTTTCGAGGATTGGGAAGACAAGGCTATTGTCCAGATCGCCTTTGAGTTCGAGCGCGAAGGGCTGCGTATCACGTGGG
ACTATGTGGCCCGTCGGATGGATAGGTCAAGCCGCAGCGGACGCCAGCTCCGGTTGCGGTTAACGAGCCTGAAGCGTACACACGGAAGATCTCTACGCGA
CTTTCCTCGGTGCTTCTTTAGCGGTTACGACCCGAGGAGCATCTTGGTAACTCACGCCGTTAGTAGTGCATCAACCGCAACGACTCGAGCGAGGGCGACT
TCCTCGACAGCTGAATCTGAAGATCAGAGAGCAGTGTCAAAGGTGGTGGCACCGACTCAGTAGACGTCCACGCGGCCGGAAATCCCAGAAGCAGCGTCAG
AGCAGAGCACGCCGAGCACGCAGATGAAGCGGACAGCTATACGACGCGCAGAGCGACACCGCGATCAGTATGACGAGAGAAGAgttgctgcggcgccacC
AGTAGCGCAATGCGCACATGCGGCCCCTTTACTTACGCTGCCATAATTCACGAGGGCACTTACCATCAGTTTTGGAGATGTTAGCGCAAATGATGTGCGC
CAACAAGCGGGGCAGATGGCCGCAATGCGGGGGAAGTGCTTCCTGGTAGCGTGGGAATGCTAGTGGAGGCAATGGGACCGATCAAGGCAAATTATGTTTT
CTTAGACATTGGTGCTGGGATCGGCAATGTCCTTGCCCAAGTTGCACTTACAACCAATGTAAGCGCTTGCATTGGCGTTGAGGTGCGA