Description :
From Genome Similarity Track
Location :
Scaffold_2083:47- 1218
Transcript NameFunction/comments
Phyra_87503Amino Acid/Auxin Permease (AAAP) Family

Sequence
1171 bases(100 bases per row)
TGATCGTTCCCAGGCATCCGGCGAAGGCGGCCCCAGCTCCTTCCTTCAGGGTGGGCACCAAGCACACGGGCAGCACCATGAGCGCCATGAAGATGATCCA
CGTGGTCTGGCTGAAGGCTCCCGGGAAGAGGCCATCCAGCAGTGAACCACCGAGCACCAAAAAGACGCACGGGATAAGTAGGCACGAACCCATTTGTGAG
ATGATACACAGCCAGCGACCAATCGGCCCCATGCACCACTGGCCGAGGTCTCCAAATGTCTTGACGGACTTGGGCGCGAGCAGCATGACCTTGGACATGG
TAATGGACGCGTAGATGTTGGCGAAGGCCATGAAAGCCATGGCAACAACGGCGAGGTAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACC
AACGCCGTAGATGCAGCAGAAGAGGTTGAAGGCCGACTTGGCGTCCTCAGCGGTGAAGAAAGGTCCCTTAGCCATGGTTGTCGGGGCGAAGGCGCGAGGC
AAAAAGAACAGGGGCTACGGATCGAGCGCGCTGCTGATCAGGGGGTTGCTTGAGTTGGAGGCAGCCAAATTGAAAATGATGAGGTGGGGTGGAGCCGTCG
GCAGGCAACCACACACAGGCCGCATGTGGCCGGCAGCTGTACTATGTGTAGCATGAAGCAAGACGCCAAGATTGTGCGGGAAAGGATACATGTACGGGAC
CAACTGATTAATAAAGTTTTAGTCAATTCTGCAGATCAATCGGTCTCACGTCAACATGCCGGAAATACAATGTACAGAGGTCCCTCTCAATAAGCGCATG
GACTCCGTGGCGGAGGTTGGTGAGGCGATTTCAGAGGGATTAGAGATGGTGTAAGCGGATCGGCTCAGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN