Description :
From Genome Similarity Track
Location :
Scaffold_326:47- 1180
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_326-snap-gene-0.76-phosphofructo-2-kinase/fructose-2, 6-biphosphatase

Sequence
1133 bases(100 bases per row)
CCACCGAGTCCGTGGCCAGCACGCCGCCCGTGTCGCCCGCGCTCTCGAACGCATCGTCGTCGTCCACGGACACCACTGGCGCTGCGCACCGCCACCTGAA
GCGCGTCGACAGCCGCACGATCTCGGAGCGCAAGCTGTACACGCCGACGGCGGACAAGCTCGTGCTCGTGATGGTCGGCCTGCCGGCGCGCGGCAAATCG
TTCATTGCCAAGAAGCTCTGGAAGTTCCTGTGCTGGAAAGGACTTAAGTGTGAGGTCTTCAACGTCGGCCAGCTGCGGCGCACGCTCTGCGCGGGCACGC
AGGACCACACGTTCTTCGACCCGAACAACGCGCGCGCCAAGGAGGAGCGCGAGCAGCTCGCTATGCAGTCGCTGCAGCAGGTGCAGGACTGGTTCATCTC
GGGCAAGCGCGGCGGCGACGTCGCGATCTTCGACGCCACCAACACGACCAAACTCCGGCGGAAGACGCTGCTCGATACCTTCGACGGCTTCGCCAAGGCC
AACAAGATGAGCGTGCACGTGGTCTTCATCGAGAGCATCTGCACGAACGAGGCCGTGATCAACGCCAACATCACGCAGAAGGTCACGTCGAGCCCCGACT
ACCGCCACATGAGCGTCGAAGAGGCCATCGAGGACCTCAAGCAGCGCATGAAGAACTACGAGGCGGCCTACGAGGCGCTTGAGGACGGCGAGGGTGTCAG
CTACATCAAGCTCTTCGACCTGCAGTCCAAGGTGCACGCCAAGGGCATGTACGTATCATCTTAGTGATTGCCTGGCTGCTTGATAACCATTGTCTGTGTG
GCTAATCAATTGTTTATCTTTATGTAGCTACGGCCACGTGGCCAAGTCGATCCTGCCGTACATGATGAGCTTCCACATTGAGCACCGGCCGATCTGGCTC
GTGCGCGCGGGTCACTGCACCGAGGTGCGCCAAGACTTTGGCTCGATCCTAAAGGACCCGTGTATCGCGTCGCGGTCCGCGCGCCTGAGCCCGCTGGGCG
TCCAGTTCGCCTCGTCGCTCGCGCAATTTGTGGACGACCGCACGGCCGCGTGCATGGACGACACGTCGGGCGTGCTCACGGGCGACGACGACGCGCCCTG
CCAGACGCTCATCATGACCTCTACGCTCCCGCG