Description :
From Genome Similarity Track
Location :
Scaffold_592:46999- 49389
Sequence
2390 bases(100 bases per row)
CACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTG
TCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
GGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAA
ACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGCGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCAGTCTCCACAGT
ATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCT
GGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGCCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTC
GTCTTCCCCTTTCGAACACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCTAAACGTCCTTGTAACCCGGCCGACTTGAACAGC
CAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCACGAGCGCGAGTATCCCTTTCT
CCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATAGCAGATCCCCTCATGTTCTTGAACCAGAGCTGCTGAGAC
TGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACAAAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAAT
GCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCTCTCTCTGTTGGTCCCGGGGTGGAT
CCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATTCCTTCGTGGATCCGGCATCTCCTGGGCCAGTGCTTGTTAGATTTTCATCTGGAC
AGCTGGAGTGGTCATCGCGGCAAATTCTACCTCTCTCAATTCGTACAATACCGCTGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAA
CTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAA
CTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCAC
TCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCCTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCC
CCCGCTTTGAATGGATCCACTTCTGCATTGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTACTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGC
GTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGCTGAATGCGGATATTGCGCGAGCTCGATC
CGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGA
TACACCATCAATCGAGTCAGGCCGTTAGCCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGAGATGCCC
ACGGGGACGTTGAGAAACTGACGATCTTGGCTTGCAGTAGGCCCTTAATCAGATCCGATACTTTTTCTCGGAACTGAGGTCCGCACCCTTTGAGCGATCG
GTTTCGCGTTGCCGACATCGATGTCACATTTGACTCCGCCGGCAGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGTTTTTCCAGATCTT
CTGACATAACCGATCCACTTCCGCCGGCTCGTTCGCCCCTGGATCCGCTTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATC
ACCGCCATGCCTTCTCCAAGTTCTTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCAGTCTTTGTCTGATCCACC