Description :
From Genome Similarity Track
Location :
Scaffold_14:46996- 48388
Transcript NameFunction/comments
Sapdi_VS20SDRG_0528323S rRNA
Sapdi_VS20SDRG_05284CMGC/CDK protein kinase

Sequence
1392 bases(100 bases per row)
AACATTACGACGTTCGTGCTTTCGCCGGGCGGCAGCTTCGTGGCCAAGATCTTCCGCTGCAAGCACTACGAGTTCCTCGCGGCGCAGCTCAGCCTTTTCT
TTGCCGAGGTGACGTGCGCCAAGCCGCAGTCGAGTCGCGCGTCCAGCAACGAACACTTTGTCGTGTGCCGCGGGTTTCAGTTGCCGCCGGGCTACACGCC
CGTGATGACGTCGCCGCTGCTGCCGCAGTACGGCCAGCCCAGCGAGATGAAGCGTGATCCCGAGCTCATCTCGTTCTTGGCGTGCGGCGACCTGAGCAGC
TACGACGAAGAGTAGATGTTTACAAATAGGACGCGACTGGATGGTTTTGTATTGCCTTGGCCAAGTACACTCGGATGCTCCGACATCGTATAACAAGGGC
TGCAAAGGTGCACATCAAGGTGGGCAGCAATGTCTTAGGCCTTATTGCACTAAGGGAACGTGGGCATGAGCTCGACGGGCTTGCACGCCGGTGCTTCGCT
AAAGTACTCGTGTTGGAGCGCATCGGCGGCCGAGATACGCTGGTTTGGGTCGAGCGTCAAGAGCCGCTGCATCAAGTCAAACCCGGCGTTCGAGAGCGCG
CTCTGACCGTACGTGAGGCTCGCGACAGGGAACTTCTCGCGCAGCACCGACCGCTTCGGGCCCTTCCACTTGACGTTGGCGACGTTTGGGAGGTCCGTGA
CACCCGGCCAGTTTTCTTCAGTCGGCGGCCCGAGGAGCTTAAATATTTGGTCGAGCTGGTCAATCTCGCCGCGCCCCATGAGGAGCGGCTTCATCAAGAC
AAGCTCTGCGAAGATGCACCCGACAGACCACATGTCTACCGCAGTCGAGTACGACGACGTGCCAAGGAGGAGCTCTGGTGCGCGGTACCACAGCGTCACG
ACGAGGAGCGTGTAGTTGCGGATCGGCGACCCGTACTTTCTGGCCATGCCAAAGTCGCAGACCTTAAGGACGCCGTCGTCGTAGAGCAAGTTGCTGCTCT
TGAGGTCGCGGTGAATGTACCACTTGCCGTGCATGTAGGCCATGGCCGAGAGGAGCTGGCGCAGCAGCGTCTTGATCTCAGACTGCAGGAACGGGTGGTT
CTCGGCCTTCTTCTTCTCGAGCACGTGCTTCAAGTCCTTCGTCGCGTAGTCCATGACCATGTAGATCTTGTCGGGCGTCGACCCGACCACCATCTCGCGC
ATGCGCACGATATTCGGGTGGTCAAGCGCGAGGAGGATGTTGGTTTCCCGCAGCGCCGTCACCGGAAAGCCTTCCCGGCACATGTCCACGGTCATCTTGA
CCTGCTTGAGCGCTACGATGTCGCCCGTCGCCTTGTCCCGCGCCTTGGACACGACGCCGTACGTGCCTTCGTCGATCTTGCCGATGCGCGCG