Description :
From Genome Similarity Track
Location :
Scaffold_148:46993- 50491
Sequence
3498 bases(100 bases per row)
CACCGAGAAGAGTGAAGCCCGCCCTACTGACGGGTACACAAGTTGAGGAAGGAAATACAAGGCATGGAAACGGAGTACCCCCTCCGATAGTCGGTCGTCT
GGGCACCAGTGGAGAGTTGGGTTCGCCTCATAAAATGAGCGATCGCCACTACACTACAATGGTGAGTGTTTTAGGATTTTCTGGTGACTCGGGATTTTAC
CGTGAGTCCCGGATTGCATAGGTGAAGTAATAAAGGATCCTGGGATGGAAGTGTCAGATGCAGAGGGATCGCCGCAGACGCGTTAATTTAAAGGATCCTT
AGATTATTGGAGTTTTGGGAGGGGCTCGGAAGATAAGAAAATTAAAGAGGAAGATCGATCGATCGATCCGGAAGAGAAACCTCTACCCCTTCCTGAGGTT
TCTTCGGGGTCCACCGCGGATCATGCCATAAAACACGATATGCTGGGTGAAAACCCTTCGGTTAAAATCAAACAATTATCCGCCAATACCACTCAAGGGA
AGTCAAAGACGTAGAACGTGAAGACAGCACGAGTGAAGAAAGAAGCGCCCAGGTCGGAGCACCACGATCGAAGCTTGAAGTCTATCAATCGACCGATAAA
GTTCGTGGTCGATAATAGAAACAGATGGAAGGTTAGCAGCTGGATCAGTTGGCGGAGGGATACTACTGTAAGATACTCAATAATCTTTATCAAGTGACCC
AGTGCTCCGGATTCTGAAGCCCAAGCTGATAGGAGGGATCCAAAATCCGATACCCTTACCGGCGGTAGCGTCTAAAATGCTGGAAGAGATCAACGGGATC
ATACGGCAGCTACATGACGCTTGTAGTGTCGCTGGAGTATTCAACGCCAACAAAATTTTGGAGTACGACGAAGATCAGGTGACCATGCGGATTGATCGCT
AATCGACAAGTTAATTCCCCTAACGGGTAAGTGTGATCCGAAGGATCAAGCGGACGCAGCGATCGTAGACGCCCCGAGAGGATAATACACTGGATAGTTG
CTGTACGCGTCAGCTGAATCTGAATTCGATTCCGATGTTTCGATCGGTATTCAGCGGATGTCTCTAGGCCCAAGTGGGGCGGCACATCTGCGTAATCAGG
TTGAAACGATTAGGATCGAACCACGATCGACGACCGCACGTGCAAAAGAAGAGAAGAATTTGACTACGCAAGGACACATGCAGGCGTACCTCGAAGAGGC
CATGGAACGTTTTCAACAAGAACAATGGGAGAGAGCTTATCAAGTGATCTACCCTAGCCAAAGGATCAATATCTCTAATATCTCAAGAAGCATATACCCC
GAAGGTCGAGATGGAATGGGTCCGATCGCATCTCAGTCGATTGGACATTCTTGATCATGACGATGCCGTTCTCGATGATTCGGGGCAAAGAGAGCGGAGA
CTTGAGTTGGTATCCGCTGCAGAAACGTTGCCGAATCGTGGTAGAATTCCCCAGCGTATTCATGTGTCAGCAATGACGGAGCTGAAAGAATTAAGTGGCA
AGGACAGAGATGAAGATCGGGCCAGAAGCTGGATCAGCAAGGTCAAGTCGGCGTTCCTGCGCGATTAGGCGCCTGACGAAAAAAGTGTTTGGTGTTCGTC
GATCTGTTGACAGGGCCAGCACATAATTGGTACAACCAACTGAGTCGATCTACACGGCAAAAGTGGAAACAATCGCTGAATTGTTTTATGGTTCATTATG
AGGGAAAGGGGTGTCTGTGGCTAGGCAATATTGTCTCGCACGGAAGCGATCAGATGAAACCCCGCTGAATTATCTTCATCTTCTCAATGTCGCATCAAAG
CACGCCAAGATAGTGATCAAAGAAGAAATATTGGCTACCTTGACCACACGTCACGAACATGTGGAATACTTCATTGCTACGCTGGATGATCGTAATCTGG
AAAAACAGCTGACACTTCTGCGATTGATGGATGTTGACGAGGTGGAGAAAACCCTACGTGCGTGCCAACCGATGAATAATCGCCAGTAAAAGCGTCGATT
AGATCGATCAAATTCCATCAGCGAACGACCACGTCTTCAAATCCGATGTCGTCGAATACAGCTCGGGCGGTGCGAGCGATCCGCGAGAAAGTCTAAAAGA
GCGGATAGGAATCGATGTCAATTGGATCCGGTGAGGACGTGAATCATTGTCGAGTTTGCGTGACTACTACACCTGACCGAGAAAAATTGGACAAGGATCA
CCGCGCCTGGCAGAAGAACAATGGTGAAAGGGATAGACACGATCATGGTGGACGATCGAAGACATGTATCCATTGTAGATCTACCAGACACAATGATCGA
GGGTGCTGGAAGAGATTGACGTACAAAAATTATGGTCACAAAGGACTCCCCTCTGACATATGTTTCTTTGTGAGTGCAGCATGCGGACAAATACACGAGA
GTAGCAAATGCCCTATGAAAGCATTTTTCAATTTGAGCCGAAAATGTTACGTGCCCACGAAGCATTCTGGGATGTTTCCGCCCATGATGAAGGAGATTTT
AAACTAGGACGCTCGCCAGGTTGGAATCTGACCCGAGACGAGCATTCTAGGCTTTGCATTTATGCATTTGTTGAAGGACAACGGGAGGATCAAGAGATTA
ACGATCGGATCGATCCGATCGCTAATATACATAATGATTCTACATTGGTCTCATCAATATCAAGTGTGGAAAGAGTGAACGATTACGCCCGATCGCCTGT
GAGGATGGAGCTCGACCTCGCACCAAGGGAATCACGCGGGTATTGGAAATACCACACTTTCGGAAAATGGTTCAAGCAAGCAAAAGCGGTGGGCAAGATC
ATAATGAGAATGTAACTATGCTGTTCGACAATGGCGCTGACGTGTCGATCCTCGATACTACCTTTGCTCGTAAGGTATGATGTGTGATCGACGAAAGTCA
AACTAAGAGTGCGTCGGAATTGGAGGAAATGCATATATATATATGACGGTGGGGCGGAAGAAGACCAAGATTAAATTGGACGGGTCGTTGGTGTATAATT
TCGATGTTTGGGTCGGTGATCAAGTCGGCCAAGAAGCCAGATTGGGTATGGATTTCATGGTTCCGGCAGGCATTCGTCTGGATCTAGCCGACAAAAATTA
TGTCTACCAGACGAGGTGCGAATTGGTTTGGCAGGACGGAAGCCACCTTATCGATTAGCCCTGCAGGTGATCAGCGTGAATGATCAACACGTGGTCATTC
CGGTGGGCAAATCGACGGAAATACGTATTGGGGCTGGTCCACATAAGGCCAAACTTTGGATGAGGTGAGACGTGGCGTGTGTGCCGACAGTGACTAGTGG
GCCTGGCCAGATCAAGTATTTACAGTTTATGAGCCTCAGCGATCGCGATATAATTATAGGTCATGAAACTTCACTGGTTATTGTGGATAGAATCTGACAT
GATACCTCGACCACCGGGATTCGTTTTGGTTGGATCACGACGGTATACAGATTGGACAGCGTTAGCGTTTGAAGTGACTACAGAGCGAGAGCTAGAAG