Description :
From Genome Similarity Track
Location :
Scaffold_39:4699- 5970
Sequence
1271 bases(100 bases per row)
CGATCTTGTCGGTGAGCTCCTTGATGCTGGCGCCGAGTACGTCCCGCTCGTAGAACAAGTCACGTTTCTTGTAGCCTTCAGTTGACTTGTTGATGGCGAC
GTTGAGCTCTTTGCGGCGATGTAGAGCCGCTTCCCGTCTTTCGTGAAGATGCGCGACGCGACTTGACGCCTTCATCGCGTGATCGATGGCATGCTCGAAA
CAATACTGATTGAGCTCGTCCGGCACAATGTCTGCCTTCGCGTTGATGGCCAGCGTAAAACTTGCGATGTCGACACTGCACTGGGCGTCTTGACCGTCGT
GTGGTTGCCGGCGGTGTCCACGAGGCAGTTCGGATTCGCAAGTCGAGTCGCGGAACCGAACGCCGCCTTGTTGGACGGAGCGACGATCAAGACGGGCAGC
AAGCCTTGGAGAGACGCCGCCGTTTGTCGACGAAGATCCATCGTGCACAGGCAGTTCTCCAGTGCTATAGACGCAGTGGTCTTGCCTGTCCCAGGAGGGC
CTTGGAGGAGGGCAATCGGCGCGGGACTGTCCAGTAGCTCCTTAATGGCGATCCGTTGCCCCATGTCGAGCTTGGAAGCGACGGTGCACCAGACGACGCT
CGGAAGTAACCAAGGGGGAGTCGGTCGCACTCTACGTTTCGATGTCTTCGTGAGAACAGCTCTTCAGCGCTAGCATGGACGCACCTCCAATTCAATCGCA
GCCAACCACTTGTTGGAAAGCGCGCGCGCGCGCGCGGCTTCGGCAACGGCCTTGTTGCTGCGCGCTCGGAGGTCTTGGACAGTTGTTAGTATGCGCGTCG
ACTATTCCTCGGTACATAAGATTCAAGCATTACCGATATTCGCACGTACAAAGAGCTCACCAAGCGTCATCGCCGTGACATCCAAGCTGCGGAAAATGCC
AAGAATATCCTTGTCGGCGGCCGATCCCTATGGGTTGATGTCAGCAGTGGTAGATACAATGGTGTTGATCGCACCAGCGTCATACGCAGCTTTCGAAGGC
TCGCATCGTACTTCTTGACGGTGCAGCGAACTGATCCAGCGTGGGTTGGATCCAAAATCATTGACCGTAGCGTCGGCAGGACTTGGCCAAGGGACATCAA
CGCCGAGTACTCGCGCACATTCGACGTAATGTTGGCCCCTACGACTACTGACCACTTGGTGTCGGCCCGTGGGCGGGCGTCGCCTTCAAGAAGCACAAAA
AATCTATCATCGTCCACTTGATCGTGGCCCACAATGACACCAAAGTGCTCCATACGACCACTCTACGCAAA