Description :
From Genome Similarity Track
Location :
scaffold_168:46967- 52021
Transcript NameFunction/comments
g4981.t1 conserved hypothetical protein
g4982.t1 hypothetical protein PHYSODRAFT_536754
g4983.t1 conserved hypothetical protein
g4984.t1 hypothetical protein PHYSODRAFT_468531

Sequence
5054 bases(100 bases per row)
GCTGGGCAGCGCAACATGGCAGCGCCTTCGTTCTATGAGGTGCTGGACCTCGACGCGAGCTGCAGCGCTGCCGACGTCCGCCGCGCGTACCACCAAGCGG
CGCGAAGATACCACCCGGACAAGCGCTCTAATGATGCGGGCTTAGAGAGCGCAGAAGGCTCCGTTCTTGAGGACGAGAAGCAATTCCTGCGCGTTCAAGA
GGCCTACGAGACGCTGCGCAGCGAGGAGCTGAGGCTCAAGTACGACGCCAAGTTGCAGCAGGACGATCTTGTGCGCAAGAGGGAGGAGGAAGTGGTGGTT
GTGTCCGACGAGGTCACACTGGCTGACATGCGGAGGGAGGTCCTTCCGGGCGAAGGAGACGATGAGGACGAAGTGCTCTACTCGCACCAATGTCGTTGTG
GTGACATGTATGAGATCACAGAAGACGAACTGCAGGAAGGTGTCGACGTCGTGCCATGCACAGGCTGTTCGCTGCATATTCGAGTGTTGCAGGGAAGCGC
CCATTGATAGAGACCTAAAACACCCTCTGACTAAAAAGAGAATATAAACTTTCATTTGCATGCACTTCTGATCTCTCAATGCAATCGGTTTGCGCTTACT
GCAGTTGGCGTGAATCCATAGTCGACAACTTTAAAACTCCTTGCCGCGCGGCGCCCCGTGCGATGGGTACCTCTGCGGTGTTTGAATCTGATGAAGCACA
GTCAGGCCGATGTACGCCATAAAAATAAACAGGAGGCCGAAGAGGAGACCGGCCATGATATCGGGGGTGATGTTCACGTAGTGCGAGAAGCAGAAAGCCT
TGCCCGCCGCACTGTATCCGACGAGGTAACCTGCCTCGCATAAAATCGCAGCCGCCGCAGTGGAGTTGCCCTTTTTGGTCTTTGCTTGAGCAGCGAGTCG
ACGTGCAAGCGGGTCCTGGATCGCCACTGAGACGGCGTCATTGCCTGTGAAGGCAAAATCTGTCTTGCTGCTCGTAGCTGCATTGAGACTGCTAGAGGCT
GCCTGAATGGTGGAGTCCACTTCGGGAAGCGACATCGACTCGGGCAGTTGAACAACCAGCAGGTCCGTGACACCATTGGCAAACAGCGTTTTTCCCTCCG
TAGATGCAATGAATGCATCCAAGTCCTGAGCTCCGACGATGTGCGGCTGAGCGTTCGTCATTTCAGAAAGAAGAGGCTTCGAACGGATGGTATGCGGAAC
CACCACCGACGACACGGAGCTCTGAACAGCGTTCTGCACGAAAGAGCTGGCACTTCCAGAAAGCTGGGAAATGTCCTCTGAGCTCAGCGACGGCAGGAGG
AACAAACACATCAGCTCTGTTTGCTCGGATGAAGATGCTTGAGTGCCTAGCAAGCCCTATTACAGCCGTAAAGGTTGTTGTCAATTAAAAGAAACACAGC
AGTATGTGTTGTCCAAAGCGAACAAACCTCTTTATCTGCGCTGGCATCACGCGCGAGGACACGCCCGACAGCTGACGCCACAGCAACCTCATCCATCTCG
GAGCTTAGGTAGGTGTTGGGCCCAGCGAAGATGCTAAAAGACAAAAAAAAAAAAAACTGGTAAAGTCACATATTTATATGCGTGGTAGAGAAATCAAGAC
AGAACGCACGGGCGCTGGGACCACATAATCAGCGGCACGTGGGGGAACAAGGTGGAGGCTGTCGAGGTTGACACTGTTGCCGCCAGACCACACAGCGCGG
CGCTAAGCAACGTCTTCTTCATCATCGTTCTAAAGGCTCGTGGGCTTTGGATCTCAGTTTCCTAAAGCAAAGGAGTTACAGGTTGTGTTATTTGTTGTAT
ATAAACCACCGATTGAAAGTCTCTAGGACTAGAGCCACCGAACATGGACCAGGCCGACCCGTTTTGTCTAGGGTTTGAACCGTTTTTCGCGGGCACAAAC
GCAACGGAATCTTGACTTTGACTGGATTGGTCAAAGGAAATATATATATATGTAGTTACATCTGCAAATGCCTCTACAAAAATAACCGGACACAAAGAGA
TACAACTCGCAGGTACGACGACGCCCCTATGAACATGCCCGCCGGCTAGCTAACTGCTCCTCCCCCGTTGCTGTGCGCACAGACTTTCTCCACTTTTTAC
ACCCCCCCCCCCCCCCCCCACGAGACCAAAGATGTCGTCTATCCTCGCTTCGCTCGACATGAGCCTGGACGATCTCATCGCCCAGAAGAAGACCAAGGCC
AGGAACCCGGACTCCCGACCGGCTAAGGAAGCGAAGGAAAAGGACGCTGCCGGCCCCATCCGTGGCGGACGCCGGCGCAACCGCAACCGCAACCAGCCTT
ACTCGCGATCCGTAAGTGAGCCCACGACCTGAAGGGCCGCCGCTTCTCGATCTATTTTCTCTCCGCCTCCAACTCTCGTGCACTAGGAAAGACAGCCCCT
TGGTCTTGTCGTCTGGCATGGACAGACAGAATGAGTTTTTGATGAGGGAACCATTGGTTGCCTGCTTTCGTGCCTGAGAGCTGGGAGGACGGGCATTACG
TTGGTGCGGACATTGACACGTGTATTTTCTGCTGCTTCTTCTTCCTTGCTGTCTCAAAGCGCGGCGACAACGATGACGCCATGGACGTCGACCTGGACGA
TGCCCCGGACAGTGGCAACAACCGTGGCGGCAAAAAGCGCTCGGTGGTTGTCAAGAAGTCCGGCAAGGGTGGCAAAAAGGGTGCGATATACATCCCCAGT
TATGGTATTCGTTGCTGCTGATCAAGGATTACTGACGCCACGGTTAAAATGGCTACTTGACCTCTAGGCGGCTCGTCGATCTTGTCGCGCCTCGGTGGCA
AGGATGCAGCCAGCCCCGGCACCAAGATCTTGGTGAAGAACCTGAAATTTGACATCCTCGAGGAAGAGGTGCGCGAGCTCTTCGGCACGGTGGGCGAGGT
GTCCAAGGCTGAGATCGTCTACGACCGCTCGGGCCGCTCGAAGGGCATCGCCCGTGTGTGGTTCGCCCGCCGCTCTGACGCAGACAAGGCTATCAAGCAA
TATGATGGTGAGTCTCGTTTTACGCGCCTTGCGTTGTGGCTTCCTTCAATGCTAACGCCGATGCGACTTTATGCAATATCCATAGGTCGTACGCTGGACG
GCCAGGCCATGCAAATTGCGCTGGACGCCGATAAGAATGTGCGCAATGGCCTATTTGGCACAGCGCTCGACCGCGACGACAAGGATGTCAAGTTTAAGGT
GTCATTCGGGTAAGCCCAGCGATCTAGAGAATGCAGTTTCGGAATAGTGATCAAAACTAATGGATGTGTTTGTCCTTACAACAGAGGAAACAACGACAAC
GATCAGTCTAAAGGCCGCCGCAACAGACGCCGTGGACGCGGCAACGAAAAAGGTGGCCGGGATGGGTAAGTTGCAACGTAGTTGTGCTACTGCTGTAGTA
TCGATTCTAAATCTGTATGCTGTGCACAGTGGTCGTGGAAAGGAGACCGCTTCATCCAAGACTGCCGAGGATCTGGACAACGAGATGGACACGTACATGA
AGGACGCATAAAGGAAAGCGTGGTGCAGACTGGGTAGTCTCCGGTTGAGCTCAAGGAAGCGCTACGGGGTGCTATTGCAAATGCATAGTTGTTTTTTTGC
ATTTTAACGGGTGTGCGTGGCGAGCGGGTGTTTGTATTCGACGCCTTTCAGCAGAGCATTGACGTGTCACCGACGTATGAGAGGACGAGTGGCTGATCAA
CGCCTTTGCAACACGTGCCCCAATTGAATAAAGCATCTACATGAACCTGAAAACGGATACCCGGCCAAGTGGCGAGCGGCGAATCGTGCGCGTTGAGCTG
CGAACCAGATGAAGATTGATTGTGTGGTGCTCGAAGTCGTATCAAGAGGCTTGATTCAAAACTTTCGATTCAAAAGACGTACCGGGACAAATTTATATAG
GATATTCGACCGATGGTCCTAGATGACGACCTTCAGACACTTTCCGCAGGACACCGGCTTCAACGTGCCCCAGACCTGTACCTCCTTCGCCTATGCGCAC
AGGATCGTGCAGCCTGGAAGGACTTAACCGAGGCGCTTATAGCGTACGCGCCGCTTAATGGACTCTGGTCGAGAGAAGAGAGAAACGTAGAGAATGAGAG
ATAACCCGACGCATGCGGAAGTTGAGCCACTCCGGTGGCAAGACGGCTCGCGAAACGCGTTTACATACATACATACATACATTCGGAGGGCATCGTTTTA
GAATAGAGACGTTGCTGATTGGAGCTGTGAAGTACACTCCATGTATCTGATTGGCCGCTTTCGATAACGGATATCCTGGATGGGAATTGAGACGGAGGCA
GAGCTGCATGGCTGGCTAGTGACCGGCGTCTTTGCCTTGGGGGTGGTCACGTATGCGGCTACGACATTCATCACGGCACCCTATGGCCGCCATGTTCGCC
CAGGGTGGGGACCAACGGTGAATACTCGGCTCGGTTGGGTGCTGATGGAGAGCCCGTCAGCCATTTGGTTTGCAGCCGTTTACTCGTGGGGAGACAACCG
CTTCCAAACAACCCCTGTCATAGCGGCAAGTCTGTGGGCATGCCACTACGTTTATCGATCCTACGTCTACCCATTCCTGATTCGCACAAGCAAACACAAG
CGCATGCCAGTGACTGTGATGCTTTCGGGAGATTTCTACAACGTGATCAACGCTTATATCAACGCCCGGTACCTGAGTCAGTTCGGCGACTACAGCGAAG
ACAACCCATTCATACGTCCGTCGTTCTATGTTGGAGTCGCGCTTTTCGTCTTTGGGTTGTCGATGAACATTTACTCGGACTGGATTCTGATCAACCTCCG
CAAACCGGGGGAGAGCGGCTACAAGATTCCACGCGGCGGTCTGTTCGAGTATCTGTCGTCACCAAACTACTTCAGCGAATTGCTGGAGTGGGCAGGCTGG
ACACTGCTGTCTCAATCACCTGCAGGTCTATCGTTCACAGTGTACACTGCCACAAACCTGGTGCCTCGAGCGTTGAGCAACCACCGCTGGTACCAGGACA
AGTTCCGCGATGAATATCCGGCCAACCGCAAAGCCATCCTTCCGTTTCTGTGGT