Description :
From Genome Similarity Track
Location :
Scaffold_10:46967- 49018
Transcript NameFunction/comments
Physo_130057LOC779536 protein

Sequence
2051 bases(100 bases per row)
TAGTGCTCCGCAGCCAGCAGTGCCTCGTTGTCGAGGGCGTCCTCGTCCAACATGAGCGAGACCCTTCTCTTCGTGGCGTTTGTGTGGTTAAGAATGGACC
CGTTTTGGTAGTCCACCACATTGAGCGCAATGCCCACGAGGCTGCCCAAGACGCCAAACGACACGAAGAGCAACTCCACGCCAGGAATGTACCGATCATC
GTGGTTGAACTCAGCAGCCACTGCCAGCGGAAATAGTGCGAGCCCAATATTCTGTGGCAAACAGATACCGAAAAACGCAAGCATTTGCTTAGTATCGAGT
AGATTTTTCAAATGCCGCATGGCCCAGCCATTGTACAAACCTGGATCGCAGTGATCGCTCCATATGCAGTACCGACGTGCTTCGCCTCCACCACGTCTGC
ACAAACGCAAATAACGCAAATGAAGTAAGTAACCAAACAAGGTGAAGATTCATAGAGCCCAACCACTTCAACCCATCGGGTACTTACACGGAACGGACGG
CCACAGTGCTGCGGCGAACACGCTGTAGGCGACGCCTTGAAGCACCAGCGGCACGTAGAGACTTACCTGAGTCAGTCCGAGCATGACGTGGACCGCGGTC
AGCGCGACCGGAGCCACTAGCGCCAAAAACGCGCGAAGACCGATTCGGTCGACCACAAACCCGAGGAACGGAGAGATGACCGCACTAATAATGTACGGGA
TGGACATCGGAGTTGCAGCTTTCTGGGCCGCATCCATTTTCGTGGCACAGTATGTCTGCGTAAAAGGTCCAAGCCTCCAAGCTTCGTCGTCGCAATTGAT
CTTGTCTCCTTCAATTAGCGGAGGGGAAGTCGAGCAGTTCCATTGATCGAGCGGCTCTTTGATTGTGCAATTCGCTGACAACAACGGTAACGGCCACCCG
TATGGAGGAACACTGGGGCACCCCGGTACAATCTCGGCGCAATCGATCTCGAAATCGTAAAGCCCTTCTCCGCATCGTCGGCACAGCTCAGGGGGCTCCT
TGAAAAAGTCCCGCTCCATAAGAAGACTGCTCGCGACGTTGTTGAACGGGATCACGCAGCCATAAACCACCAGGCAGCTCAGCGCCAAGAGCCAAAAAGC
TGGGCGGAAATGCTTGATATCACTGAAGTGGATGCTTTCAGCAGCCACTCCTGCCTCTTTCTGGTTCTCTTTCGTCAACTTTTCCGCTCGTTTGTCGATT
GGTATCAGCAATAGCACCATGAAGGTAGACGCCAGACACATGATCACGCCCACCCACAGTGCCGTGGAAACGCTTGATGCTTGGGAGACAACAGGACTCA
GTTCGTTATTGATGACGCTCCCCAGCCGCGCAACACTGAGGTTGATGCCCAATGCCAGCGCAAGTTCGCTGTTCTTGAACCACGAAGCGACGAGCGTTCC
CTGAGCCACACCGAGACTTTCTCCGCCAAATCCAAACACCACGCGACCAAACTGAAGAAATGCAACAAGAAAACTGTCAGTTCCGTTGAACTAACATCCA
ACACAAAACGACAACGTTTGGCTTACCAGCATCAAGTTGAAGCTCGACAAGGAACAGCCCGTCGCGAAGATCAACTGCCCCGTCAAGATTGCCGTCGAGA
AGGTGAACAGCATCACCCGCGCACCGAACCGATCCACCAAGACGCCCCCGAAGAACGGCAGCAGGATGTTGGGGATCGAGTACAACGTGTACAGCAAGTT
CTGCAGGTAATATCAATGTGCAATTGGTTAATACTCTCTGTACCGCCCAGCAAATGCCGACATTTGTCGCTAGCATGCAGCAAGATCTCAGGTTTAAGAC
GTACGAAGAGGAACTCGTAGCGGTCCTTGGGGATGGTGTTGAAGTGCTGCTGCAGCTGGCTCTTGAGCGCCGCCGGGTTGTCGAAGCAGTAATAGTTGCC
GATCATCAGCAGACACGACAGCAGCAGCACCAGCCACCGCACGCGCAGCTCGCTCTTCTCCATGGCTTCTCGAGGGGGGGGGGGGGAGGATGCGGCTCTG
AGTCAGATCACCTTTTGGATTTGGCGTTTCGCCTAAGTACGATTGAAGTGA