Description :
From Genome Similarity Track
Location :
Scaffold_1336:4696- 8490
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1336-snap-gene-0.5Esophageal cancer associated protein, partial

Sequence
3794 bases(100 bases per row)
AGCGCGTCCTCGGCCGCCTGGATCGCCTGTTTGCTGGTATCACTCAGCAAAAGTCCGCGCTTGCGCAACGTTTGGAAGTAATTAGCGAGAAAGAGCCGCG
TGCGATCATAGTACCCGCGGATCCACGCCAGACGCTTGCGCGAGTCACTGTCAAAGCTCTCGACTGCCAAGCCTATCGGCAGCGCACTCAGCTTCTCGTG
AGCGAACGCCATGCACTTGCGCACGAGCACGGCACCGCAGCGACTGCGCTTCCGACGTCGACTGCCACTATTGTTGCTGTTGCTCCCACTCGACGAATTC
TCGGGGTCGAAGAGGTCTCGGCTACTGCCACCGAAGGCTTCGGGCATCTTTGAGTCGTCCTGTTCAAGCACAGGCGCTACTTGGTTGACGAAATCGAGCA
TCAACTCGATTTGCACGATCAGCGTATCCACTGAGGCAGCCGCGGGACCTGGTGCTGCTTTAGCCTGGTTGTAATAACTCGGCAAAGACGATTCTGCGAC
TCGGTCGTCGCCTGCTGAGCTGTTAGCAATCACATCCATCGCTTCGACCTGACGCACAATCTCCTCGATCGTCTCTGAGAAGTGCACATGCACTTGAGCT
TCAAACTCGTCGTCACCGCCGTACAGCACGTCGTTTGAATCCAAGCCCGTGATTCGCCCAGGAAGCTTCTTCTGACCCCACAGGCCGTACAGCTGCAGCA
GGAACAGCAGAATGCGCACGCGTGAGCTCGTGGCCGTGACTTGGACGCGCTGGATCGACGAACTCGAGAGCGAGTCCCACGCCATGCGCTCGAGCACCGC
TTTCCGCAGACCGTTCACGAAATAGAACGCGTCGTCATCATTCAGCGACGGCGCGTACACCAGCACGCTGACCAAGTTGCCGATTGTCCTCAGTAGTCCG
CCTTCCGACTCGGTCGACGAGAAGAAGCCCTGCGAGTCGATCTGTAGCGACGAGCCCAGGAGCTCAATCTCGTCGATCGAAGAGCTCATTCCACTGTCGT
GTCCGGAAGCAGAAGAGTACGCTTTGCTCGGGTCGAGCTCGGTGATCTGGATGATCGCAGCCTTCAGGAACGCGTCCATCTGCGGCAGACAATTGTTCGC
GAGCGCAACCTTGGCCGACAACGTCATAAGCTCCAGCTTACAGAACGGATCCGAGATCGACGGTATCGTGATGTGCGCATAAGCCAAGCACGACTTGATA
AAATTGCGTCGGTCCTTGAACTTCGCGTCGCTCATGAGGCCACCAGATCGCGTGTGCACGTGCATCGCCAGCGTCAGGACGTCCTTGGCGAGCGTCGTCT
TGACGTGCTCGAGCTTGTAGAATGCGCTGCGGCAGTCAATGTAGAGCATCAGCAGTGCCTCTTCCTCTTCCTCGTGGGCCGCGTCGCTCCCACTCGGATT
CGCGTAGCCCAAGCGCGAGATGAACGCGCAAATGTCCTTCGAGGCATCACTTCGCTCCGTGAGCGTACTCAGCGAGTCCAGTGCGTCGTGGACACGACAG
CAGATCACGAACAGCGTGTGTGCCACCGCGGCCTCGGGCCCGACCACATGAAGCCGCATGCTGCCAGAGTTGTTCTTCTCCATCCTCATATCCGCACCCA
TGAACGCCAGCAACACTTTCTTCGCAACGCCGACACTGGACTCGCGCTTGAACATCCCCATCAGAGTCTACATAGCCATTCATTCATATTCACCGTTTTT
GAATTAGAGAAAACCGATTTCCAGAGAATGTCACAGTGTTCCAACATGTGTACCAGGAACTCGCCCGACGGGATCAGCTTCGTGAAAAACTCGTAGTGGT
CCTGTGCGCCGTAAACAACGTTCTCGATCAGCGCGCCCATAAGGTTGTACGCCTTTGGCGTGAGCTCGTTGGGCGTCGCCGAGTTCAGGTGCCGCACCAC
GTCCCTGAGCAGAATCAGCGCCTCGCGGTGCTGTACCACACACAACAACAGAACGACAAATTAGCCTAGTACGTCGACGGAAACCAATTTTAACAAATTC
AATTTCAGCGTACCGAGAAATGGGCGACAATGAGCTTCATGAACGCCGCGGCGCACTCCATGTACTGCACAATGTCCTCCTGGGACGTGATCGACGTCCA
GGCCTCGTTCAGGAACTGGAGCTTGCCCTCTTTCGACGCTGTCAAGGTCGGCGACGTGCTCAGCTGCAGCGCCAACAAGCTGTAGAGATGGCATTTCGAG
TACTGCGACGGTGCTGAGACGCGCATGAGCTGGAGCATCACGAGCGGATTCGACGCGTAGTACTGCGGCCCGAACGCCTCGCAGATGTGCTTGAGCACCA
TGGAATTGTCCGAGTATTCACGGTAGTGTGCCAGGATCGTCTCGAACGCGTCGTGCGTGCACTCGCTACTCGCGACGCACTTCATGAGCCACTCGACAGC
CGGCGAGTGCAGTCCCAGGTACTCCTGTTGAGTCATGTTGTTCGCCTGCAGCCACATCTCGAGTTTCTGGAGCTGGAACTGGTTGAACGTGAAGAAGTAG
TCGAAAATGCTGCTGAGCACGGCCGTCTTGTCGTTTGGCGGAAGCAGTTCCGAGCCGCACAGTGCGAGGTACACGCGGGTGTAGAGCGCCACCATGGGCT
CGCCAACGCCTCTATTGTTGTACATTAAGTAAGACGTGAGTGATTGAGTGGTTGGTTGATTACCGGTGATGGATCGCAGGGATGCTCATGTACGTACTTG
ATCATGTTGGACAGCCTCGACACGATCTGCGGGTACTCGCCGTCGCACAAGAAGCGATAGCATTTCAAGAGCGCCACCTCAATGTAGCTAACGTCACACA
ACATAGCAACAATTGTCAGAGAATATCATACCAGCAGCCCACCATTGTCAACAATGTTGATCAATTCCGTACATTCTCGGCAGCAGCTCACGGATACACG
CGGTCTTGTAGAACCAGTTGCGGCATGTCTCCTTGGCCTGGATGTTGACGTCGCTGCTCACAAAGTTCTCCGAAAGCGGCGTGGGCAGCGGCTGCCCGTT
CTCGTCCTCCGACGCGCGCGTCTTGATGCGTTCAAACACGAGCTTCCCAAACGTGTCGAGCACGTCGCTCACGAGCACAAACACGCACGGGTAGAGCTGC
GGCGAGCTCGTCGTGTCGCCCAGCAGCTTGACGCACTTGATCGCGATACGCAATGCTGCGACTTTCTGATTCTGGTCCCAGGCCGCGACGAGCTCTTTCT
CCATGATCTGGATCTTCTCGACGTACTCGCTCTGCGTCATCTCGACCGTCTTGTCCTCGTTCGAGCGCTTGGAGCTGCTAGCACGCCGAGGCTTACGCTC
GAGCTCTTCGAGTCTCTCACGAGTCTTCTTGATCACGTGGATGCTGTCGGTGGACGTGGCGCCATCGACGTCTCGCTGGTATCCAGCCTTAGATGTCCAC
GAGATCTCGCTTTCGAGGTCGTGGGCTTCCAGCATGTTCTACACATACACACGTTGTAGGTATTAGTTAGCAGAGCCATACCGCGTAAATTTGTATACAC
TAGCGGAATGAAAGACGTACCGCTTTGATCTTGAACGTGATGTTCTCAAACTTGGCCAGCACGCGGTCCTTGTGCGACTTCCAGAGCTCCTTCACGGTCT
GCGACGTCTGCTTCTTCTCACGGGGCGTCGCGCCGTGGATCGACATAGACGACAACTTCCTGTCCAGACCAGCAAAAGGAGACGTGACACCTGCAGAAGT
GCTGTCTGAGCTGGCCTGCGTGGCGTTATCAGAGAGCCCCGCAGTGAGCACGCCCAGCGGATCAATGTCACCGTTCTGCAGCAGCACCAGCTCC