Description :
From Genome Similarity Track
Location :
Scaffold_903:4695- 6953
Transcript NameFunction/comments
Phypl_g11552hypothetical protein
Phypl_g11553conserved hypothetical protein

Sequence
2258 bases(100 bases per row)
ATGATCTCCGATCTCAAAAGCCAGTGGTGTCGCTCGCCGACCGTGAGACCTTGTTTCGCATCATACTGCGAATTTCCAAGATGAGTCGGCAATGCAAGGA
GGAGATCAGCTCTCTCGACGGCGAGGTAGCTGTGATTCGCGGGGTTTTGGCCAGTGGCGACATAGGCGATTGGAAAACAGAGTCTCGTGTGTGGACTCTT
TGTCGGGAGGTGCTTCTAGAGCAGCTTGTCGGCAACCCCAACAGTCTCGATCGAGCTCATGAAGCGGTTGTGTTCATGCTGAAGCACTCCGACGCGCGGC
TTCAGCTCTTTGGAGCGCAGGTGCGTTTTTCTTTCATTTATTTTTTTGTTTTATATTACCCGCACATCAAACTGCGCTGAACATCAATCCTAACATGACA
GATTCTCCGAGAGTTAATCTCTGAGAATTCATTCTCCTTTGACTCAGAGTATCGAAAACGGAAGGACTGTGATCTCGTTCCTCTTTGCCTATCTCTCCTC
AATTCGAATGACGTCTATCTCCAGCACGAGagtctcgagcttcttcacgctctATTGCAGTCGAGACATTTACAGGTTTGCCTGCTCATTCGTGTGCGTG
ACATCTTGGTTCAATGTTGCTGATCGAAGTAGTGTTTCAGGACATCATTTGTGAGAAGCTTGTTCGCTTGGTCGGAGACAGCGCCAAGGCACTGGATGTG
TAAGCTCCTACGAACAAGTATCTATCCTGGCATTGATTCCCACGATTTCTGACTTCCGGTAGTATGATTATGGATGTTTACTTCTTTCTATGCTCTTAGC
AAAGTTGAAGAGCGATTCGCCTCAATCGAAGATACTACAGAGCATGAAACATATGCCCACCTCCGGTCAGCTTTTGCTCAAACATCCCAAGCCGTCAATG
CTCTGATGAACTCGAACCGTAACCTATTGCCGATTCTGGTACGCCGGCACTTCAAAACACGAGTGTCATATATCTAGCTCGTTTCACTAATTGTAACTGT
GTGAGCAGGTTGATCGGTGTGGTCTGCTTATTCCTTTGGCATTCGTGCTCGTTGTTGAGCGACCTCACTCGCTGAAATGGCATTCCGCCGCGATTAGTAT
CCGCTTTATCCTTTCGCACCACCGGGTGAGCACTGTCTTGGTCAGCTTTAAATTGGCATCCGTACTGATCAATGGAATGTCACGTACGTTGGTACTAGGG
GGCGGCTGATTGCATCGCTGAGCTCTTTGAAGTCGCATTGGGGGAGCTTCTTGAATGGAAAGACAAGCgaggagatgacgacgagatgTTTGCCGAGTTC
CTTTTGGGCGATGGtgcccaccagcgccaccttgcTCTCCGATTTTACCAGCGGGGATGGTATCGTCCACTATCCCCGAGAAAGCAGTCAGAGCAAGCTG
GCGTAGATCGCGCCCTCAAAGCCATCGAGCACAGTGTcgagacagcagcacgcgactACGTTCCTGAACTGCAAGTGCAAACGCGAGTGGGTGAGAACGC
CGACGAGAccgaggagatggagatcTTGGAGGTGCAGCGTGagcaccagctgcgcctccagctgcagaaacACTTCGCGCAGTTCCGCCACATATCTACA
TCAGCaacgaccaccaccagcagcaactagAAAGACACAACTAGCACTCTACGTGGAATTAATACTACGCGGATGCCGGCAGTGCCGGCAGCTCCCTTCT
CTTCCCAGCCAAAGCTGTTTAGTTCTCCTCGGGCGTGTAGTGGTCCTCGAGGAAGCGCGagagcgtctgcagctgctcagACACGACCTTGACCTTCTCG
CGGcagatctccacgtccttTTCGGCGCCGTAGGTGCTGCGCGCGAAGGAGCGGTAGTCCGAGACCAGGTGGATGTGGTTGGCTAGCTCGGTGTGAATCT
CCTtgaccagctgcaggaactcggtGCACGCCGCGTtgaaggccagcgacgagctctcCTCAGACGACACGCGCGGATCCATGAGCGACATGgcggtggc
cgccgtgcgcaGGGCCGTCACCAGTTTCTAGCGGCAGACATCAACCAAATGGCAAAGGTCAGTTTCAATCTGGGAGTCTTATATGCGCAGGAGACAGCGG
GTTCGCGCAGAAATTCCACGGTTGGTAAGCAGGCAGACACACACACCtgttcgacggcgtcgagcgcttgcagcaccgccacgtGCCTCGAGTTGGACCA
CGGATCGCTCACTTCGGAGAAGTGCACGCggctgtcgccgtcgccctcCATGGTGTCA