Description :
From Genome Similarity Track
Location :
scaffold_946:4695- 6720
Sequence
2025 bases(100 bases per row)
TCTACCAGCGGGCGCTCTTTAGGGTCTAGTATCTTTGCGCTGGTGAGCTCGAGTTGACTTGGCGTGTGGTCACGTTCCCGTATATATTGCCGGATACGCT
GGATATCCTGAGATTTCAGGGTAGTCATCATGTTCCTTCTGGCGGTATGAATCATACCCAGCTCGCTTAACAATCTTTCTGTCGTAGCGGTGTTCACTGT
GACCGAGAGTAATCTGATTGCAAGATCAGGCAACACACTTGCCGGGTTCTCCTTTTCGACGTGCTGCCAGAACTTGATCTTATTGAAGCGAAACTCTTTT
GGGTGTGCAGATGTAAGGGTGTTTTCAATCCACTCGATCAGATCGCTTCGAATACAATCATAATCATCGCCAAGAAGTCGTCGATAGTAGTAAACGGCAA
ACTTCCCGAGCTGTGCTGACGACACAATTCTAGCAGCCTCCTTGATATCATAAACTAGCTGGTGTTCCACTGCAACGCCAGTGTGCCCTCCACGCACTAA
GCGCTCTACCACATCCACTACTCGCTTGTGATGGTCAATATGTTCAATCAGCTTTCGACATTCGTCAGCAGTCGCGGGGTTAAGAAGCAACGTTAGCATG
AACAAAGGCTGTTCACACTGTTCCCACCGCGATTCAACACACTCCACCAATTTACTGCGGTAGCCCGACAGAACTTCACTGAACCCGCAATATATACCTC
GAAAGGACAAAACAACATCGGCTAGTGTGTTCTCACCCCGCTGAAGCCGGGACGATGCCTCGGAGAGCGGAGCGATTACCTGTTTCGTTTCCTCCAGTTT
CCTCCAGAAGGAGCGATCACTGAACACCTCAAGTGAGCTCGGGAAATCTTTGTAGCCTCGGTACTTGCTTGCTAGCTTTTCCAGGGAAGTTCGAACGCGG
AGGAGTGACGCAAAACAGCTCTGCATGCTGTTCCACCGTGTTTCACACGGTGTAAAGAGCGCTAGAGGTTTCGCATAGCATTCGATCATCAGAGCCCTTG
CTCTTACAAGCCATTTAGATGACGAGGTATTCAGGCATTTCACAGCAGCAGTTGCGTCTTTTGCAACGAAAGGAAAAGCTGATTTCAGGGTTGTCCTTAC
AATATTGTTAACGAAATGCGCAAACCAAAACAAAAAGACCGTATTCGGCCAACGCAAGGCCAAGATGCGTCGAGCCCTCCCGCCCTGACCTGCGATATCC
GTGATTCCAGCGCCGACATTCCAGTCTTCAATTGCCATTTGACGCAATTTGATGTCCATCTCCTCGGCAATAGCCGTTCCGTCATGTCGACTTCCAGCTT
GCGGCAGTGAGTAGGTAAGGTTCTGGCCAAATAGCTGCAATTGGCAACCGAGTACATGCTCTCGAGAAATGTTTTGCCACACATCCGATAAGAAGTTTAC
GTAACCTCCCGTAGTCAATTGCTCCTGCTTCAAATTTTTAATCTGAACTTCACGGCAATGAGCAGCATGGGTCTTCAAAATGCGACCACCTAGCATACGT
CTCGAAGGAAGGTATGATGCGATTCCAGGACACAGGTACTCCAACAACGCTCTTGTACACGAACGTTCAATAAAAAGATCCGGCAACAAATTGCCAGCCT
GAAACTCGACTAAAAGTCGCTCCAATTCTAGTTTTTGGATATTCGAAAAAAGTCGGTGGGATTTCGACTTTAACAAGGTCCGCTTCGCTGTACCCCGCTT
CAGAGATGCCTTTGTAAAAACTAGCCGAGTATTCACTCGCCGCTTTTCGCGATGTCCTGATCCAGCACTTGAATCATCTTCACTGGATTGCTCTTGAGTT
GGGCCCACAGCATGTCGATAAGATTTACACATCCGAAGGTGGCCAACATAGTTGTAAGTGCACCCTAATATAAGCCCAGGGGGATCCAACTCGGGGTTCA
AATTGTATGCTTGCGTACAATGTTTGCAGGTATAAAACGAGAAGTTTCCTTTGTTCTTGGGTACATCACGCATTAGCGTAGCGTGATGTTGTTTCGGAAT
ATGCGGTCGGCCCATATTCACAAGT