Description :
From Genome Similarity Track
Location :
Scaffold_826:4695- 6598
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_826-abinit-gene-0.4Myosin

Sequence
1903 bases(100 bases per row)
ACACACTGCCGCCCCACGTGTACCAGGTCGCCGGTGGCGCGTACCGGCAAATGCTCAGCGGCATGAACGGCATCTTGAGCGACCAGTCGATTCTCGTGAG
CGGCGAAAGCGGCAGCGGCAAGACCGAGTCGACCAAGTTCCTCATGCAGTACCTCGCGGCCCAGGCCGGCGGCGGCGCGGCCCCGTTCAACCCGGCGCAG
TCCATGTCGGGCGGCATCCAGCACGGCATCGCGGCCAAGGTCCTGCAAACCAACACGCTGCTCGAGTCGTTTGGCAANNNNNNNNNNNNNNNNNNNNNNN
NNACGACGGCGTCGATGATCGCGAAATGTTTCACCGTGTGGGCGACGCGCTCGAGGTCGNNNNNNNNNNTATTAAGCTCCACTTTACGAACGGCGGCAAG
CTCACGGGCGCGAGCATTCAGACATACTTGCTCGAGAAAGTACGGCTCGTGTCCCAGTCCAAGGGCGAGCGCAACTACCACATTTTCTACGAGATGGCCA
TGGGCGCGTCGCCCGCCCAGCGGAGACGGTGGAGCCTCGATCCGCCGCCCAGCAGCGCCCAAGGGGCCGCGGCAGACTCGAGCGAACTGCCCGAGACCAT
GCGCCAGTTTCTCCACTATCGTTTTTTAAACCAGAGCCAGTGCTACAAGCGCCGCGACGGCGTCGACGATCGCGAAATGTTTCATCGCGTGGGCGACGCG
CTCGAGGTCGTAGGTTTTACGCCGTTTGAGCAGGCCGGCATCTTTGATCTCCTCGCGGCGCTCATGCACGTCGGGAACCTCACGTTCGAGCACGACGAGC
GAGACTCGTCGGGGCCCGCCGCGGCCTCGACCAACGCCACGGACTTGGCACCTAGCTGCATATGGTCCCGCGACGCTGCCGCGCGTCTGCTGGCCGTGGA
CGCATCGCAGCTTGAGCGCGCACTGAGTGTCCGCAAGATCCGTGCCGGGACAGACTTTGTCAGCGTAAAGCTCTCAGCCGAACAGGCCAACAACGCCCGC
GACGCGTTGGCACGCGCGCTCTACGGTCGCCTTTTTGACTGGATGGTGTGCAAGATCAACGAGTTCTTGAAAATGGACGACGCGCAGAAGGCCAAGGGCC
ATTTCATCGGCATTCTCGACATTTTCGGCTTTGAAGTCTTTCCCCACAATTCCTTCGAGCAGCTCTGCATCAATTTTGCGAACGAGACGCTGCAACTCCA
GTTCAACGACTATATATTCAAGATGGAGCAGCAAGAGTACGAAGCGCAGGGTGTGGACTGGAAGTATGTCGAGTTTCTGGACAATCTCGACTGTGTCAAC
CTCATTTCGCAGCGGCCCTACGGTATTCTCCCGCTCATCGACGAAGAGTGTCTTATCCCCAAGGGCAACGACGTTACGTTTGCCTCGAAGGTGTACAAGG
CCTGGGACGACCACGTGCGCTTCTCGGCCTCGCGGATCCAAAAGGCCAATGGCAACTTCACGATCATCCACTATGCCGGCCCAGTCGAGTACTCGACGAG
TGGCTTCCTCGAGAAGAACAAGGACACGCTCCACCAAGAGGCCGTGGATCTTCTCGTGCATTCGCCACGCGACGGCAGCTTCACTAAGATGCTGAGCGAG
GGCACCGACTTTCGCCCGCGCGACAAGGCCTCGCCTCGTCAACGTGCGGCCGCCAACAAGCAGCGCGGCGCGAGCGTCGGCTGGCAGTTCAAGGAACAGT
TGACGACACTGCTCGAGACGCTCCAGCAAACCAACCCTCACTATGTGCGGTGCCTAAAACCTAACGACGCCTGTGAGGCGGGCGTGTTCGCACGTGACCG
CGTAATCAACCAGTTGCGGTGTAATGGCGTCATGGAGGCCGTGCGCGTCGCGCGTGCCGGGTATCCGATTCGCGTGCCCCACGAAGAGTTCGTCGCTCGG
TAC