Description :
From Genome Similarity Track
Location :
Scaffold_252:4695- 6462
Transcript NameFunction/comments
Aphin_H310_14837threonine synthase

Sequence
1767 bases(100 bases per row)
TCCGCCCCAACATGACCAAATACCGAAGCACTCGCGGCGACGTCCGCAACTACTCGTTCGAGGAAGCTGTCCTGAGCGGCTTGGCGTCGGACCGAGGCCT
CTTCGTACCTGAAGAGAACAGCTTCCCATCGCTACCTCCAAATGCTCTCTCGGAGTGGGCGTCGCTGTCCTACCAGGACTTGGCCGTGGAAATCATGTCG
CTGTTCATTGACCCCAACGAGATTCCTCGTCGCGACTTGGAAGCCCTTGTGAAGAAAGCGTACACGTTTGGGGATGCCAACTACCGCCACAAGGACGTCG
CTCCTATGGTCAAGATTAAGGACAACTTGCATGTGCTGGAATTGTTCCACGGCCCAACATTTGCCTTCAAGGACATTGCGCTTCAATTCCTTGGCCACCT
CTTCGAGTACTTTCTTGAGCGTAAGAACAAGAACAGCGATACTGTGCACCAAGTGACGGTCATCGGCGCGACGTCGGGCGACACGGGAAGCTCTGCTATT
TACGGCCTTCGCAACAAGAAGAACGTCGGAGTGTTCATCCTGTTTCCCAACGGCCGTGTGAGCGACATCCAGGAGCAACAAATGACGAGCGTCATCGATG
ACAGTGTGCACAATCTGGCAGTCCAGGTACATTCTGACAGGTCCATCCGTCCTTGAGTGCTGATGGATGGCTGGCGAAGGGCACGTTCGACGACTGCCAA
GCCATCGTGAAGGATCTGTTCGCGGATACCGCTTTCAAAAAGAAGGTGAGCTCATTTGAACGTCACATCCCCGCCTCATGCCGTGGATCGTCCAGTACAA
CCTCGGGGCAGTGAACTCGATCAACTGGGCGCGCATCCTGGCGCAGATTGTGTACTACTTCTATGCGTATTTTCGTCTGCCGAACCGGGACAACGTGGTG
TTCTCGGTCCCCACTGGCAACTTTGGCGACATTCTCGCTGGGTTTTACGCCAAGGTGGGTGCGCTCTCGAGTGAATCCTGCACCTGATGCGTTAAGCAGA
GATTGGGGCTCCCCATGGAGAAGCTCATTGTCGCCACCAACGACAACGATATTCTTCACCGATTCTTCTCCACCGGCAAGTACCACCGCACCCATGTCAA
CCACACAACGAGTCCGTCGATGGACATCTGCGTCTCGTCCAACTTTGAGCGGTACCTGTTTTCGCTCTGTGGCGACGACCCCGCCGTGCTCAAGGAGTGG
ATGACTACATTCGAGTCAACGGGAAAGCTTACCGTCCAAGGGACTCTGCTAAAGAAGGCCCAGACCGATATGTCGTCGTATTCCATCCTGGAACCGGTAC
TGTTTGGTATGAGCAACGCATATAGCTCTGATGCATGGATGATGGTAATAGGAAGTGCAGTCTACCATCAAACAGTACCACGTCAAGCACGACTATGTGC
TGGACCCCCACTCTGCAATCGGGGTGGCGGCGGCTGACCATTACCTCGAGTCCGAGTCCCCCAACGCTTCGGTCGTAGTGTTGGCTACCGCTCATTACGG
CAAGTTCCTGCCAACTGTGTTGGACGCGTTGAAGGAAGGCGGTGCGGAGGTGGAGCAACACCCAGTTCTGCAGGCCTTGGAAAAGTTGCCTCGTCGCTCG
TTTGTGATCGAGAACAACGTGTTCTCGGTCAAAGCGTTTGTGGAGTCGCATGTCCGACGAGAGGAGAAATCCACTCAAGCGGGGTACTTCAGCTCCATTT
CGCAGTCTCTTCTCCTCCAAGGGTCGCTCCTCGTCGCGGTAGTTGGCGTGGGAGCGTTCCTCGCGCT