Description :
From Genome Similarity Track
Location :
Scaffold_112:46948- 48249
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_112-fgenesh-gene-0.3Cysteine protease family C01A

Sequence
1301 bases(100 bases per row)
GATTGGCAGGAATACGGCTGTGTCACCCCTGTGAAGGACCAGGCTCAGTGTGGTGCATGCTGGGCCTTTTCCGCGACGGCCGCCATGGAGTCGGGAGTCT
GTGTCGAGACCAGACAGAAGTCACTACCAGATCTCGCGGACCAGCAGCTTATCAGTTGCGACAACCAAGGTCAAAGCCAAGGATGTGGCGGTGGTTATTC
CTCCTACACCATGGACTGGATTGCCAAGTCGCGTAATGGCAAGATGTGCACCCTCAGCACGTACCCGTTTGAGTCATCGGCTGGCAACGTGCCAGGATGC
AAAATGAGCAGCTGTAGCGAGATTGACATTGGTGTGACGGGCTTTGAGAGTATCCGCAAGGATCCTGGTGCCCTGGAAGACAAGGTCCGTGAACGCCCCG
TGTCGGTCTTCCTCTAcAGTGGCTCGCGTGCCTTCCAGTACTACGCAGGTGGTATTCTAACGGGTGAGAACTGCGACAAGAGTGGTGAGCACTCGGCACT
CGCAGTTGGCTTTGGTGAAGaGAACGGTCTGCTGTACTGGCGCCTGAAGAaCCAGTGGGGTACCAATTGGGgTGAGAACGGCTACGTCCGCATCCAGCGC
CGCTTCCCGGgTGACTCGGAGGgTGCCTGTGGTGTGGAACTCTACGCGTCGTGGCCAACGTTCAAGTCGAACCTtAaCGTTGACGCGCCAAaCccGAaCT
TTGCTCCAGCTCCAGCTCCTACACCAGCTCCTACGCCAGCTCcTGCACcAGCTCCTACGCCAGCTCCTgCACCAGCTCCTACGCCAGCTCCTGCACCAGC
TCcTACACCcGCTACTACGCCAGCCCcAACcacGGCCccAACcACCGCACCAACTGCTGCTCCTACGTCGGCACCCACAACTGCACCGACCACTGCGCCA
ACGACTGTGCCAACGACTGCGCCAACGACCGCACCAACCACGGCCCcAACCGCTTCTCCAACGTCGgCACCTACGACTGCACCGACCACTGCACCAACGG
CTGCACCGACCACGTCTGCTCCAtcGTCGTCTCCGTCGGATGCCCCAACACCTGTGTCAACCACACCAGCTCCAACACCAGCTCGCACGACGCCAAcTTC
AGAGCCTCAGCCACTGCCAACGACTTCGTCTCCGATCCAGCAGATTGGCATTCCAGCAAACACACAGCCAGAAGTAAGCAGCGATGCTTCGAGCGACGTG
TGCGGTCGTCTCGACgACGGTGTTGACTACCTCGGAAACGACCTGAAGGATGTCTCGGCCACCTCGCCTGGTGACTGCTGTGCTCTTTGCCAGAAGACTC
C