Description :
From Genome Similarity Track
Location :
Scaffold_24:46906- 47930
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11263hypothetical protein

Sequence
1024 bases(100 bases per row)
CGCGCATCTTCGTTACGCACAGCACGCAGAATTTCGTTTTGACGATCTCGAACGTCCTGTTTGATCCCGTTGACGCGCTGTCAGCGTCTTCCTCTTTGGG
GGCGTCACGTACGATGGCGCACCGCCGACAAATGAGATCTCCGCACAGACGGCAGTGGTGGCGACGGCGAGTTGGTCCGAACTTACGCGAACAAACGCTG
CAACTTTTACGTGATCTCGACTTGGCCCAACTCTTCCGTTGCATCACTCCTTGCATCAAAATGCGTCGCGAGTCCACGAAGACCGCCATGTTCATAAGGA
TATTCATCATGCGCTTGTAGTAGTTGGCGGTGACCGCCAACCCGTTGAAGTTGTTCCGGGACAACATGAAGAATTCTGTCACGTTGGGCTCTCGATCGGC
AGGTCTTGAGATCCAAACGGTGTTCAGTCGAATCCGCTTAGTCTTGAGCTTTTTGGGCAGCTCTGGACATTCAGGGATGTCGAGCGGGAGCGTGACACGG
ACGCCCACATCGCGACCACGCAGGTCCTTTGTGTAGTTCAAGTATTCCATGTAGCAGTTGTCACGCTTCTTGACGAGCGGCGACGGGTTCAAACACGTCC
ACTTGATGCCCATGTACAGACATTTCTCCTTGGATGCGACCGTGTGGATGTTCTTGAGTACCGCCGCATCCGTGGCGTATCCGAACATGAACTGGTTCCA
CGCGAAAAGCTCGGCTGACGTCTCGGCGTAAAAGAAGTCGATAAAGTGGCGGTAGTCGCCGTTAATGCGGCCAAAGATACGTGCCTGGCTGGCCGTAGGG
CTGTCGGGTGTCTCCTTCTTGATCGTCGTGAGACCTTCCACCTTACCGACGACATTCCACGGGGCTCGATAGACGGGGTACGCCCCTTTCGCCTCGTGCA
GCTCGTACTCCGCCAGTGCGTTTTTGACGATCTCCTGCATCTGTGACTCATAGTTCTTGATCTCTTTGGACGTGAGGTGGATCTCCGGGAAATAGTCGTC
GGGTAACGGGAAGTGGCCGCCGTT