Description :
From Genome Similarity Track
Location :
Scaffold_114:46902- 50447
Sequence
3545 bases(100 bases per row)
GTAGAATTCGAGGGGGCATTTCACATATAGGATGACCCACAAACAGCCCTGCATACGCATCAACAGTTTCTTCCTCTCGTTCCGTAGTCGTTTCAAACGC
TAGTGTTTGCCATTCTGTACCGCCGTGATCCGATAGATGCTTATCCCGGTGATCGATGTATCATGTCGCATGCCATCCTCAAACCTAACATAGCTCCATG
ACATATAATTATATCGCGATCGCTGAGGTTCGTAAGCTGTAAATACTCGATCTGACCAGGCCCACTAGTCACTGTGGCACCCACGCCACGTCTCGCCTCA
CCTAGAGTTTAGACTTAGGTGGACCAGAACCGATACATACTTCCGTTGATTTGCCGACCGCAATGACAAATTTTGATATTTCAGGCTGATCGCCTGCATG
GTTGATCGATAAGGTGGTTTCCGTCCTGCCATGCCAATTCGCACCTCGTCTGGAAGTCATAATGTTCCGTCGGCTAAATCCAGCCGGAACCATAAAATCA
ATACCCAATATGGCTTCTTGGACGACTTGATGACCGACCCAAACGTCGAAATAATACACCAACGATCCGTCCAATGTAATTTTAATCTTCGTCCGCCCCA
CCGTCATATACACATTTTCTCCAATTCCGACGCAATTTTGTGTTTGAATTTCGTCGATCACACATCCTACCTTACGAGCAAAGGTAGTATCGAGGATAGA
TAATTCAGCGCCAGAGTCGAACAGCGTAGTGGCTTACTCATTGTTAATCTTGCCCGCCGCTTTTGCTTGCTTGGACCATTTTCCGGGAGTGTGGAATTTT
CAATGCCCGAGCGTTTCTCCTGGTGCGAGGTCGAGCTCCATCCTCAAAGGCGATCGGGTGTAATCATTCACTCTTTTCACACTTGACATTGAAGAGATAA
ATGTAGATTCATTATGTATATTAGCGATCGGATCGATCTGATCGTTAATCTCTTGATCCTTCCGTTGTCCTTCAACAAATGCATAAATACATAGCCTAGA
ACGCTCGGTTTGTGCCAGATCCCAACCTGGCGAGCGTACTAGTTTAACACCTCCTCCACACTGGGGGGAAACATTCCAGCATCCTTCGTGGGCAAGCACC
ACTTTCTGATCAAATTGAAAATCTCTTCCATGGGTCATTTGCCACTCTCGTGTTTTTGTCCGCATGCTGCTCACACAAAGAAACATTTGTCAGAGGGATG
TCCTTTCTATCACACTTCTGTCACGTCAATCTCTTCCAGCACCCTCGATCATCGTGTCTGGTAGATCCACAATGGATACACGCCTTCAATCGTCCACCAC
GGTCGTGTCCATCCCTTTCACCAGTGTTCTTCTGACAGGTACGGTGATCCTTGTCCGATTTTTCTTGGTCAGTTGTAGTTGTCACGCAAACTTGACGATA
ATCCACGTCTTCATCGGATCTAATTGACTCCAATTCCGATCTGCTGATTTAGACTTTCTAACAGATCAATCGCACCTCCCGAGCTGTCTTCAACGACATC
GGATTCGAAGAGGCGGTCGTTAGCTGATGGAATTTGGTCGATCCCATCGATGTTTTTATCTGGCAATACTCCATCTGTTGGCACGCACGTAGAGTTTCCT
CCACCTCGTCAACATCCATCAACCGCATTAGGGTCAGCTGTTTTGCCATATCACGAATATCCAGCGTAGCAATGAAGTGCTCTACAGGCTCGAGACGTAT
AGCCAAGCTAGCTAATATTTCTTCTTTGATTGCGATCTTGGCGTGATTTGCCGGAAAATTTAGGTGATACAGTTATTCCAGCGGGGTTTCATCTGATCAC
TTCCGTGCGAGATAATATTGCCTACCCACAGACAACCATTTTCCTCCATACTGAATCATATAACAATTCAGCAATCGCTTCCACGTGTGCCGTGTAGATC
GACTCAGTTGGTTGTACCAGCTTCGTGCTGGCCTTATCAACAGATCGCCGAACCTTAAACACTTTTCTTCGTCAGGCTCCTGATCGCGCAGGAACCCGGC
TTGAACTTGCTGATACAGCTTCTGGCCCAATCTTCATCTCTATCTTTGCCACTAAATTCTTTCAGCTCCGTCATGGCTAACACACGAATACGTTGGGGAA
TCCCACCACCATTCTTCAATGTTCGGTGGTGACCACCATCTCACGTCTCCGCTTATCTTGCCCCGAATCATTGGGATCGACATCTTCCGGGTCGAAAATG
TCCGATCGTACCGATTCCATCTCGACATCTGGGGTGTATAAATCTTGAGCTCTTGAAGTCTTGATCCTTTGGCTAGGGTAGATCGATTAATACGCTTGCT
CCCTTTGTTCTCGTTTAAACCTTTCAAGGCCTCCTCAAGGTACGCTTGCAGGTGTCCTTGCGTAGTCGAATTCGTATCGCCTTTAGCACGTGCGGACGTC
GATCGTGGCTCGGTCTTGATCGTTTCAATTCGATCGCTTAGGTGTGCCGCCCCACTTGGGCCTAGAGACGTCCTCTGAATATCGATCGAATCGTCAGACT
CGATTTCGGATTCAGCCGAGGCGCACTGCGACGATCCGGTGAGATATCCTCTCGAGGAGTCTGCGATCGCTGTGTCCGCTTGATCCGTACAATCACACTT
ACCTGTAAGGGGAACTAATTTTTTGTATAGCGATCGAGACGCGTGGTTCACCTGATCTTGATCTCACTCCAGCATTTTGTTCGCGTCGAACACTCCGGCG
ACTAAACCAGCTTTATGTAGCATCCGTATAATTCCGCTGATTTCGTCCAGCGTATTAGACGCTCCTGCCGGTGGGGGAATTGGGTTTTTAATCTCTCCTA
TCAGCTTGGGCTTCAGAATCTGGAGCACTGGGTCACTTGATAGCAAATTAATGAGTGTCTTCCGGTGATATCCCTTCACCAACGGATCCAACTGCCAGCC
TTGGATCTTCATATTGTCGTCCATGAACTTGATCGGTCGATTGATCTATTTAATAGCTGCGATCGTGCTGATCCGATCTGAGCGCTTCTTTCTTCATTCG
TACTGTCTTCACGTTCTTCATTCATGACTTTGCTTGAGTGATCTTGAGTAATAACTGTTCGGTTTTATTCAAAGGGATTTCACCCAGCAGATTGTGCTTT
GCGGCACGATCCGCGGTGGTCCCCGAAAGGATCTCTGGAGGGGGTGGAGGTTTCTCATCCCGATCAACCGATAGATCTTCCTCTTTGATTTTCCTGTCAT
CAGAGCCGCCTTCAAAACTCCTATAATCTGGGGATCCTTTTAAAAACGCAACATCGGCGATCCCTCTGCCTCTGACACTTCCATCCCAGATTCCGTCCTT
ATTTTCTCCTTTTCACTACGGGGCTCACGGTTGAAACCCGAGTCACCAGAAGATCCAGGCACGCCCACCATTGTGGTTCAGTGGTGATCAATCATTTTAC
AAGCGATGCCAACTCTCCACTGGCGCCCAGACGACCGACTGACGGAGGGAGTACTCCGATACCGTGTAGATGTATTACTTCCTCACCTTGTGTAACCGTC
AGTAGGGCGGGTTGCACTCTTCTCAGTGGACTCGTGTCGAGGGAA