Description :
From Genome Similarity Track
Location :
Scaffold_52:4690- 7327
Sequence
2637 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCACTAAACACTTGGTGGCAATTTGGCCGGACTTCCGAGACAACACTAGGAGGATTCTGGAAGCAAAACT
CGGGCATTATTTTCAGGAAGAAATACTCTACTTTTGATACGTAGCCATGTATTTACCAAACTACGCACTGTACGGGACTAGACTTGATTGAAATTTGTGA
CTGGGTTTGGCGGTGCTTTCCAATACAAACATCAAGTATAAAGGATTTGTATTGACCCGGAAAAAAATCGATCGAGTTTTCTGGTACATGTTGCTGAACT
GAGCAAGCCCAGCATCGCTACCATGTTGAATAGACGCCAATGAAGACACTAGTCAGCTGACAGCCTCAACTTACGAGTATAGACCTCTCCACACTGTCAA
ACACCACTCTTCTATACAAATTCAAGATAGTGCGTGTCTCCATTGAATCTTATCAACCGCGTCAGCTTAACCTTATTTGAGCAGCTTACTACAGTGAAGT
GCGTCGATAAGGAACGGGCGACATTTTATATTCTACGACAAGACATGAATCCTCGCTTGTACCCATTGTGTGCCAATTGTACTGAATTAGTTATATGATT
CTACCAATCATTCGGTCCCGTTTAACATTCCGCCAATCACAGTTCCGAAACCGAGCCTTAAGAGCGGCTGGATGGAGCGGCTCCCAAGTCGGGGGAAATG
GAACCTAAAGGTCGCGAGAGGGAATCATGAGCATGAGGATCGCTGTGAGCGCGGGAATCGCGCCACGTACATGTCTGCATGCCTCATTAACCAACTTTCG
CTCTGCTGCTCACAACTCCCATGGTGACCGCCACTTCCAGACCGTTCCAGAGGCGGCTACGTCTGACCAAGCTTCAGTCGCTGCTAATCTGTCATCGCCG
TCGTGATCTACCGGGTGCTACCTATGCTGAGTTGGCTGCGTGGGCTCGAAGCCGAGACTCTGGTCGCGAAGTCCGACATGAACTACATAGTGCAGTAAAT
CAGTGCATTTGCTGTCTGCATGTGACGAGTCAAACCTTTAATTATCAATATACCTTTTTCTTTCAATGTATATCAGGCGTTCCTTATCGACGCACTTTAC
TGTACCGGTAGGCGTTATTCGAGCTGTTCAATGGAGTTAGTTCATTTATTACGCTTGGAACAGCTCTCCACGAGTTTGTTACCAATCTTACCGATAGCTT
ACCGGGTGCGGCTATAATTTTGACCCGACCCAAAGTCGGTTTTTCGTCCATTGCAAAAAAACGGTTACAGCTTTTTCGATTCTGATTGTTGCATCTGTTT
TCTATCGTATTGGTTTAAAAAAATAATTTTTGGGGTGCGGTTATAATTTCGGCGCGCACTGTATATCACGTAGATGCGGTACCGTGTTTCTGGTACAAAA
CTGAGGGAAGAAAAATCCAACCGGCCATTTCCACATTTCCCCTCCAAGCCTTGTCCTGTAGCGCCACCGCCCACCGGGACTAGCAGGCATGCCCGCGCCC
TTGCCAACGTCGTCATGATACTACTGCCGCATTGCTGACTGTGTACTGCTGTGCTGCTGCAGATGGACATGTCCAGCCACTTGGATCCCCAGGCTTTGGC
CGCGTTCGTGGACGACAGTGTCTTTGCTCAGATGAGCGGGAAGCTTGGAGCAGACGCATCGCCGAAGAAAAATCTTTTCGTTGCGTGGATGCTGGACGAC
TATCCCAACAAAGCCACACTCCAACTCGAGGCCTCCCAGAAAGAGATACAGAAATTGATACGGGTGGAGATCAGAAGAGCATACGGGCATACACGCGTGT
CTCGACCTCTTGCACAAACTATTGCGGCCAAGACGGTGAAAGACCTCCTGGCAAAGTTTGTCCCTGAAGCCCGCTCTGGCACGCCCAAGTTGGATGAAAA
TGAAATGAAGCGAATCGCGGAGGCGTTCATCAAGGGCCGGTACCTCGGCGAAGCCCACCTCGACCTCGCACAGTATCTGCGGGACTGCTGGAAGGCCTAC
ACCCCCACAAAGTACAAGGCGCCATGTGTGGCGGTCGTGCAGAGTTCTGGCTTCGGCAAGAGTCGGACGATGCGTGAGCTCGCGATCGAGGCTCAAAAGA
GCGCCTTGAACATGAAAGTCCTGTACATGTGTGCTCG