Description :
From Genome Similarity Track
Location :
Scaffold_541:4690- 6510
Sequence
1820 bases(100 bases per row)
TTACATCGTAGGCTCCAGACATTTTGCTACGCGATGTAGCGGATTCCACCGGCAGGTCACTCCAGTTCTCATTTAAATATGCCTTCAAATTTCGTACCCA
GCTCTTCTCTTCTTGCGCCTTTTAAATTTGGTCACGCGAAGTCGTTGTACTACCTCCAATTGCATGGTGTCCCCGGTATATTTTGCTGAGAGACCGCGAC
CGAATCACCGCAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTGTACTATCCAACCGATTTGCGATCTGATTCAAATCTCGTTTTAAATGC
AGGATACCATGAGAGGGCCACGGTTAAAGTTCATTCAAATACCGGGCTTGTAGCGGGAACAGCCCCGAGGTTTTACACTCAATCTTTCCTCGCATCTGCT
GCACCACTAANNNNNNNNNNTGCATGGTCTCCCTGGATTTCCTAATGGGATACCGCGACCGAGTCACCGCAAGTATTTTAGTTGAGGGGCTCTGGTCTTT
AGGAACTAGCAGCTCTGGTAGACGATTGATTGATTCTAAATCTGGTCTTTCTTCCCGCGGGGTCTACTGGACCCCCCCCCNNNNNNNNNNTGATATTTCT
TCACTTGGCTTCAACTCGACCCCCCCTTGCTGGTGCAAGGCTGTACTAGCCAACTGATCTGAGCTTTAATCTCGATCTCGTTTTACATGTAGGATCCCAT
GAGAAGGCCACTACTAAGTTTGATTTAAATCTCGGGCTCGTAGTGAGGACAGACCCGAGGCTTTACACTCAACATCCCCTCGCATCTGCCGCACCACTAA
ATNNNNNNNNNNCAATTGCCGCCCCGTATATCCTGATGGGGAATTGCGACCGAATCACCGCAAATATTTTGTGGAGGGGCTCTGGTCTTTAGGGACCAGC
AACTCCGGTAAATGTTTCATCGCTTCCAAACCTGGTATTACTTCATTAGGCGTCGACTCGACCCCCTCTTGCTGATGCAAAGATGTACTGGCCAACTAGT
CCGCGCTCCGATTCTATCTCGTTTTTCATGTAAGATCATTGGAAGGGCCACTACTGGAGTTCAATTAAAGCCCGGGCTCGTAGCGGGGACAGTACCGAGG
CTTTACACTCAATCTCCCCACGCATCTGCCGCACCACTAAATTGGAGTCTCCACAGATAATCAACGCCGTTGCTCCAAAGGTTTCAGAAAGTTGAATCCC
AGCAACATATCCTCATATAGTGCCTCATTTACCGTAGATGTGTCGAGGTACTTGNNNNNNNNNNCTCTACAGATAATCAAAATCACCGTCGCTCCAAAGT
TTTCAGCAAATTAAATCCTAGCAACATACATTCTTTTTCACCTCATTTACCATAGATGTGTAGAGATACTTGGAGTTGGCTTCGACTATGGTCCATGCTA
GGAGTCTCCATACGATAGCGCTACAATCNNNNNNNNNNCATGCTGGGGACCTCCATACGAAAGCGCTACAAGCCCCACCTCCTTTCTTAACACGGGCTGA
CCCATTGAAACATTACAAACGTCCTTCGTCTGGTTCCACGGTGGGGGTAGGTAGGTAGATCGTCCGCCTTACCTGCTCCTTAGGGGAAATGGCCGACAGT
ATTGAGTATACAATATCTAGAGGGGTAATACTGGCTGACAATGCCCCCANNNNNNNNNNGAACCCATTGGAACTCATTACGTACAGTTCTTCGTCTAGTC
CGGTGGGTAGGTAGGTCGATCGTCTGCCTTGCCTGCTTTTAAGGGGCAATTGCCGACAGTATTGAGTCTACAATTTCTCGAGGAGTAATACTGTCTGACA
ACGATCCCATCACCTGGGTT