Description :
From Genome Similarity Track
Location :
Scaffold_1865:469- 1825
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1865-snap-gene-0.1U3 small nucleolar RNA-associated protein 11

Sequence
1356 bases(100 bases per row)
AGGAAGCACCATGTCATCGCTGCGCAACGTGGTCAAGCGCCGCGAGCACAAGGAGCGCGGGCAGCTGCGCGAGCGCAAGAAGCTGGGGCTGCTGGAGAAG
CACAAGGACTATGTGAAGCGCGCGCGTGACTACAATAAGAAGCAGGACCACCTCAAGACGCTCGCCGTCAAGGCGGCGTTCCGCAACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGCACAACCACCACAAGCAGCTTTCGGCGGAG
GCGCTCAAGGTGCTTAAGACGCAGGATCTCGCGTATCTGCACATGAAGCGCGCGGTGGATCTGCGCAAGGCCGAGAAGCTCAACGAGGGGCTCCACTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAGGACGAGGTCGAGTCGTTCGACGTCGCCGAACACTTCGACACGGTGCCTGAGCTCGCAGATCGCGCGTT
CAACCGCCTGCGAAAGGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCATCGAGCGCGA
CGCCGTATACAGGGAGTTGAACGACCGACTGCAGCGCGCGTCGACGATCGACCGCATGCGTGCAAAGCTTGACCTGGAGCGGAAAGTGCAGGCCAAGGGC
AAGAAGATGAAGATCAAGGACGCCGAGGACGGCCAGCCCGCCGTGTACCGCTGGAAGAAGCAGCGTCAGAAATAAACGTCAGCGCGCACACACACATGGG
TAGATTTGAATAAATAATAACACAGCATGCATATCTCTCTCCGCAAAAACTCGCTATTCTATCAGTGTCATTCAGGCAACGTATCGTTTGCCTTTTGAGG
CTTCTCTACAAAGTTTGAGTGTGCGCGGACGTAGTGATGGCCATACGCCTACATGGCAGCAATAGGTAGACAGCAGGCAGCATGAGTCCCATCATTTGCA
ATTCGTGAAAGAAAACACGTTAGCGTACGCACCTTTCGGATCTGCTGGAGCAGCTCTAGGATGATCAGCCTGTCCCCGTTGTAGATCTCAAGTTTGCGGC
GCAAGAGATGCAGAGGCATCGTCTATTATAGAAAAAGCAGCAGCCCAATAAGGCGAACCTTTCATAGACAGAGTTCCTGTTTTGGTCAGCCACTAAGTAC
CTTTTTCTGCTGCAGAATCTCGAGGGCCTTGGAGATGTTGTGCAGTGCCGTGGCTTTGGTCACGTTCGGTTTCCGGTCGATGCCTTGGATGCAGCGCATG
TACTCCACTTTCTCTACGATGCAGCAGAGTAGCACACCTGATTGAAACTCCAGCAA