Description :
From Genome Similarity Track
Location :
Scaffold_518:4689- 6194
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_518-snap-gene-0.5ATP-binding Cassette (ABC) Superfamily
Pytar_ATCC12531maker-par_contig_518-snap-gene-0.9Conserved gene of unknown function

Sequence
1505 bases(100 bases per row)
CGTGATCCTCGACGAGCCATCCACGGGCATGGACCCGAGCGCGCGCCGCAAGATGTGGAACGTCATTGCCTCGAGCTGCGCCGTGCACCGGACGAGCGTC
GTGCTCACGACCCACAGCATGGAAGAGTGCGAGGCGCTGTGCTCGCGCGTGGGCATTCTCGTGCAGGGCCGACTGCAGTGTCTCGGCAGCGTGCAGCACT
TGCGCCACAAGTTTGGCCGCGGCTTCACAGTTGACATTAAGCTCGACAGTGAGCCCACAAAGCTGCAGGTCGCGTCGCTGCGAGGCCGCGCCCACGAAAT
CTTGGAGGACCATCCAACCGAGATCACTGAGGAGCAGGTCGCGAAGCTGTGCGAGGCACTGGGCGACGCCTCGCGCATGGAGCGTATCGAGAAGGCGGCG
CAGGGCAACGCCGAGTGGTGGAGTCGCGGTGCTGGGGGCGTCCGCACGATGGAGCTGGACCAGTTTGCCGCGTGGTGGCTCGCACAGGACCGGCACGATG
CGCTGGCGTCCTTCTTCCCCCAGCGGTTCCCGGGCACGACGCTCGTGGAGCAGCACGGCGACCACGTGCGGTTCCACATCCCCAAGCACGCGAGGGAGTC
GGCCGTGGGCAGACACGACCGCGCGTCCGAGTTCGAGCTGCGGCCCAAGGCGATTTTTCAGGCGCTTGAGATCGGCAAGCAGACGCTGTGGATCCAAGAG
TACAGCGTGAGCGACACGTCGCTCGAGCACATTTTCAACCGCATGGCCGACGACGGCGTCAACGACGCGGACCGTCTGCGTCCCACGATGGAGGCCGACG
GCCAGCGCAGCAGCAGGAGCAGCAGGAACTCCCATCGTGAAGGGAGCTCGTCCATGTCTCAGTACGCGCAAGGGGCCACGACGGGCCTGTAGGAGTAGTA
ACTAGAAGCAACACTTATCTAATGCAACGCATGTAACTTCATTTACCGGATCACTGTGCTTGCCCACCTTCGGTTTGAAGCGCTCGTACTGTACTTGCAT
GCAATGGCATTCAAAGGAGCTCCTCACTATATGTATTTATTCAACTGGCAATTGACTTTCTCTTGAGAGCAATGGCAGGGGGAGCATTCATTCCACGGGG
CCGTCGTCCTCGTGGGAGCACCTCGTTCAGTACCCGTGACTGTCGTTGTCGAAGCGGTCCGTCTCCTGCCCGGCTCCTCGTTGGTGGCTCGGCTGTCGCT
TTTCGTCGTGTGCCGCTGGTACGTCGATGTCCGTATGGTGGGCACCGCGTTGGTGTCACAGCCGTCATGCTCGACGAGTCGTTGTCGTAGGAGCACACCG
CGCATGTGCCGTACGTCGGGCGTACGTCGTGGCCAGGTGAACGGAGCACACCTGATCCATTTGGGGTGCCATTTCGGCTATTCAATGGCCCGCGTCACAC
ACCAGCGCGGGGAGGGCGAACGCCGCTGATGTGTTCTGGTTCTCGCAGAGTGGCGAGCCCGTCGCGAAAATCGCTGGTGTTCGTGGGAGCCGAGGTATCC
AGTGT