Description :
From Genome Similarity Track
Location :
Scaffold_121:46889- 49069
Transcript NameFunction/comments
Phyci_555358conserved hypothetical protein
Phyci_96285conserved hypothetical protein

Sequence
2180 bases(100 bases per row)
TGCGGAAAAATCGTCGTTGTGATCGAGTGCTTTGAGGCGGTGTTTGTGCTTACTTGGAGCTTGAAGAGCACTGTCAACAGAGAACGAGCGCTGCATCGTA
GACTTCTTACGATCGTCGTGGGTTTCGCGTCCGTCAAGCTGCAAAGCTTTCTTTCGTAAGCTATCTAGCGTTCCAGATGAGCTTTTCCTAAAGACCGCAG
ACGGATGTGGTATCTCCACTTGGTCACTTTGCGTGATTGAGCGAAGTAAGCTTGAATCAAACGCGAATGAGAGGGCTTTGCCGTCGAGTGTGAAGGTCCC
AACGCCTTGAAGTGTCAATCTTCCAGCACACTCACCGCCCCGGAGCTTCGTACCGACGAACGCGAGGATGGCATCCAGTGACCGACGTGTCTGATCCGAT
CCAAGTCCGGCATCACTACCAAGAGCAGCCATATTGACCTCTGCAGTCGCGGTGAACGGTGCAGGGGACGAGCGGTGGCGCCACACAACACCGTACGTTG
AAGCGAAGCGATCTGCAAGCAGGAACACTGGTGCGCCGGCCATCATGCATGTCTGTGCCTTGTAGAACCCAAACTTTCCTAGCTGCTGCAGCGACACCCC
CTTCCGCTGATTAAGCTGCCGAGCCACAAGTCGACCGAAGGCTTGCCATACACTAGTTACCGATGCTCCAAGTAGCACCTCGAACTCAAAACTGGACGAC
CGAAGGTGCTGCGCGCACTCTGCCAGAAGATCGCCCGCCCTACTCGGCATGACGACGCTCGTGAATTCAGTTAGACCAAGTACGCAAAAACTACAAAGCA
ATGCTGGACAACGAACGCTCGTCTAAATATTTCTTCCCTTATACTGATCGGCATGCTTGACAAGAAACAAAAGCGCAGCTATTTCTGTTCGGCGTAATGT
TAGCTGGAGTTCGACCGCCGAGACTTTAATACAAGCGATCGCTGCTCGCGGTTGAGCGAGTACGAGAGAATCTGCCCACCGAACGTAGAAGCCAGCAGCG
TGTTGTCGTCTACCCTACACAAACCCGTGAACATTCGCTTCGCTCCATCTGCGTGTGCCTCGGCTAGAGGGTTGAGCGTTGCGGCGTCCCACACCTTCAC
CGTGCCGTCCTTGGACGCCGTCACCGGAAGCATCGGTAGAGCTGAAGGATCCGCCTCATTATTATTGTCTGCACTACGAGGCAGGAAGCAGCACACGGTT
GCGTCCTGCTGGTGACCTTGGAACTCCACGACCTGCTTGCCCGTGCGTCGATCCCACACTCGCGCCTCACAGCCAACGCCATTGAACCCCTTGCTAGACG
TCAGTAGGTACGTGCTGTCCTCTTCACTGGCGCTGCCATACGCCGCAATGCTCAACGGGAAGTACACAAAACCCCTCAGCGTCTGGGCAGGCACACGCAG
TGGCGTTCGAGGATCCCACAGCTTCACACTCAGGTCTTCGCTGCCTTGAGCTACCAGCGGCTCGCGCGGGAGCCACGTTGAGCACGTCACCACGTTCTGC
GGGGTCGTGTTCTTGGCCGCGATGTGACTTGTTGTCAGGTCCCAGAAGATGGTCTGGGTATCTCGCCCTCCCGAGCACAGCATCTGCTCGGCGTCGTCCA
CAGCCACCGTGGACACATTCAGCTGGTGTCCTCGCAGCACAGTGGCCGTCTCGGACGCCGGCTTGTCGGAGATGGGCGTGATGGCCACCGTCGTGTCCCG
CGAGCACGAGTAGATCATCTGCAGCTTGTCGCCGATGACGATGCGGTTCACGGATCGCGTGTGCGGCGTCCAGACGTTGACGGCGTCGACTGCGGGCGCC
GCCGCCTCGCGCCAGTTGAGCCGCTGGATGGAGCCGTCCTCCCAGCCCGCGAGGCAGTTGGCGCCCAGGAAGGAGCTGTACGCCACGCAGTGCAGCGCCA
GCTCGCTGTCCGGCTCCACCGCCGCAGCAGCTTGGTCATCCGCGCCAGTTGGCGTCGTCGCGGCGCCGTCCACGACAGTGGGCGTCTCGTCCTCCACCTT
CCACGCGTTGAGCTTGTTGGCGTCGCGCGAGTTGCAGGCGCCCATGGCGGCAGGCAGTGCAGGGTAATAGTAGACGGCGGTGGTCGGCACGATCGCAAGG
TGTCGAGCAAGTTGCATCGTCCTCGCGTCTTTCCAACGGACCTTCGTGCCGCGATTACAGACGATTTTTACTCACCGTAC