Description :
From Genome Similarity Track
Location :
contig_140:46883- 64026
Transcript NameFunction/comments
g13752.t1hypothetical protein
g13753.t1hypothetical protein
g13754.t1hypothetical protein

Sequence
17143 bases(100 bases per row)
CGTCCCCGACGTTTTGCGTGCGTAAACCCAATGGGAAGTGGCGCATGGTCCATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAAT
CCCTCGCAAAGACGTGTTACAGAATAACATGGCGGGCTGCACCATCTTCAGTGCGCTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAAATC
AGACGTCCCGCTCACAGCGGTGAGCACACCAGCGGGAGCTGTGGGAATGGCTCGTGATGCCCCAGAGGCTGTCGAACGCACCAGCCACGTTCAATCGACT
GGTGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGGTGAGACGGCTGTCGAA
GTGCACGTTAACCACCTCCGTGAGGTATTGATGTGCATGCGCGATAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAAGAGATTCCCT
TCTTGGGATGTTTCCTTGGCAAGGATAGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCTCAGAAGGACTTGCG
CAAGTGGCTTGGCCTTGGCAACTACTTACACAAGTACAGCGCCAACTACGCTGATATGGCACGGCCACTGATGAACCTTTTGAAGAAGGAGGCGGAAGGG
TCGTGGGACGATTAAGGACGGCAGGCTTTCGAGGCAATCAAAAGAAGCCTACAGAGCGCTCCGATTTTGGCTGTGCCCGACGATGATCGTCCCTTCAGTG
TGGTATGCGACGCATCCGACTTCGCCATAGGCTGTGCCCTGCTGCAGGTCGATGCCGAAGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTCAG
GGCGGCTGAAAAGAACTACCATGTCCATGACAAGGAGCTTCTGGCGATGAAGTACGCACTCGTAAAGTTTCGGGTACACCTGCTAGGCAGCAAACCCTTT
GTGATCTACACAGATCATGCGTCCTTGCGGACAGCGACGTCGTCACCCCACCTCTCCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACT
TCACGGTGGAGTACAAACCAGGGAAGCAGAACGTTCTCGCGGACGCGTTGTCTCGGCGTCTGGACTATGAGCTGGTGCACGTTGCGTATCTCGAGTCCCC
ACTCTATGAGCTGCTACGCGAGGCGTACGCAGAGGATGGCGATCTCGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACTGCT
CGGCAGCGCTCACGGTTGCACCGCTACTCACTAGCAGATGGTCTTCTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGTATCGTGGTTCCCAACGACG
AGAACTTACGTCATCGAGTCCTCTACGAGGCACACGACACGCCGCTCAGCGGTCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTG
GTGGCCACATATGTATAAGTGGGTGCGCACGTACGTACAGACGTGTGAGACGTGCCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAAC
TTGCCGGTGCCGGCTGACTGTTGGCGCTCGGTGAGCATGGATTTCATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTGGTCTTCGTCT
GCCGACTGAGCAAGATGGTGCGGCTTGTCGCGGTGAAGAAGAGCGTGACGGCGTCGCAACCGGCACAGCTCTTCGTCGACAATGTCTTTCGACACCATGG
CCTCCCGGAGGCGTTCGTGAGTGATCGAGATCCGCGCATTGTGTCACACTTTTGGACACACTTGTTCCGACTTCTCGGTACGAGATTGGACATGTCCGCA
GCGGACCATCCACAGACCGATGGTCAGACGGAGCACGTGAACCGTGTGTTGGAAGACGTACTGCGCAGCGTCTGCACTGAAGAACCCACCAAGTGGAGCA
CGCTGCTACCCCAAGTGGAGTTTGCGCTGAACAATGCTGTGCATTCGTCGACGGGTTTCACCGCATTTTATGTAAATGGCTTGCGGCATCCGCGTACGCC
GCTATCGTTGCCACCGGCTTCGAATTTGGGTGGGGGAGAGGCAATCGCCGAAGATCCGCGTGGCCTCCAAGGCCTCCGTTCGTCCGTCAAACTGAACCTC
CTCACGTTCATCGAGACAAGTAAAGCAGTACGACAGCGCGTCCGGGACGCTATGGCGGCTGCTCAAGACACGCAAAAGGAACACAGTGACAGGCAAGGGC
GTAAGAACACGCACGTGTTTAAACTTGGGAACCAGGTCCTCCTAAACGCTAAGAATCTCCCTATCCAGGCAATCACTGCGGTGGGCAGCACCAAGCTTCG
GCCACGATTCGTGGGGCCGTTCACGGTCATTGGGGTCCACGGCAACGCGTACACGCTGGACCTGCCATCGGCCATGGCCACGCATCTAACGTTCTACGTG
GGCTCGCTCAAGCCTTATCGCCCTGCTGAGACAGATGACTCTGAGAGTCCGACGAGTTCGAGTACTGCCGAAGGACGCTCGCCATCATCTGCATCAAGTT
CAGCATGGGGTGGGGCTGCAGCAGCCAACGGAGCAGCGGCCCTCTGAGGACTGCGCCGACCTCGTGGACGCTTATGAGCGTTCCCACGGAGCCGGTCGGC
GTTAACCCGGCCAAGAACACTTCGAGGTTCTATCGGCTGGGACTGCCAGGACTTCTGGACCTTCTGAAGGACCTCCTCGAGGATGACCCCCGGGGTGGGC
AGGCTGCGGTCGAAGCTGCGGGTGCGCCACTGGCCGTTGACGACCATCTTCGCCATACGAAACCGAAGACGCCGCTGGGCGAGCCAATCGAGGCGATACG
GAGAGTCTGGAAACTCAGGCATGGGTTACCCCAAGTGGCGGAGCCACTGCGTGAACTCAAGTTCTTTGGATTGACGGGCCAGGTCCGTGTCGTCGTACAA
GACGACCGGACACTCGTCGTAGTGCGGCAACCTGTGCCCGGGTTCCCGACTCCGTCGGAAATACTCGCTGTAGTGTGGCGTTGGGTTTTGGAGCCGAACT
GTCAAGGTCCGACGGACGTTGCACCTTTCAGTAAAAGGCGACAGGGTGTCTTGATTGGCTGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGT
GACCGAGGTCTCGGCTGGGTCTAATAACACCCCGACCAAGGTTAAAAGCCTCGTTTGTACCCATCTGGTGTCGTACCCTCGGCTGTGTAGAGCCGGCTAT
ACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGA
GAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGTTCGGCTGCGT
GGGATGCCTGTCAGCGAGCTTGGGGGTACAATGAACTGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGACGACGGAGAGT
GTCGGTCCCTATATATTGGAGGAACCCGAGTGTTCCCAAGTGTATTTCACTTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTCCTTC
TGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTACACATTCTAGCCCTTGCTCGTGGCTAGTTGTGCAGGTTTTAAGGTTGACCGAACTCAACCTT
GGTATACAGAGGTGCTTGCAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTG
TTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGGCCTTCTGTGTGTA
TAGGTTCTTACCCTAACGATCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAAAAGCGAAAAAAGCAGTACCAGCAACGCCGGTGAGG
TCAAGTGGAACGCGTACCGAGGGTTCGGGACGTTCCGGTCCGTCGTTCGCGACGCCGAGTACGTTGGCGCCGATCAACGAGCGTTCGGATAATTCTGATG
AGCCGATGGACTACTCTGACGCCAAGGAAGATGATGAAGAAGATGACCTGGAAGAGTAGGCAGCGATGCCCGAGCTTTCGGAAGCCGCTGCAGTGTCTGC
AGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCCACGGTTACGACGAAGATGGG
TCCGACGATCAGCGATCGTCGGCGATGGCCGAGAATTCGCATCCTCGGCCTAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGTCGCCAACCGAG
TCCGGGGCCGATACCTAGAGCTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTG
GCGAATTAACTGGGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGTCGAGGTGAGGCGAGGCGGGTGAACGCCTTTATCGTCCAGGGTGTATAGCGCACG
CGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTTGCCTTTCGGAAAGCCCAATGGGGTCAGACTACCTCCAAAAGTACGGGACCCCCGGAAGTAG
CTTGGCGTGTGACCTTGTGTAATCCCTATAGGTGTCGTTTGTCTTCGAAGACCGGACTCCACTGATGAGTTGTTCCTACACAATCAAAATGAATACAAGA
ATACAGAGTGCGTACGTTCACTTCCCGACGCAATTAGTACAGCTGGGGTTAGACCACTAGCAAAGCCTTCCCAGATGACCAAATAATACAGAGAGTTATA
CACAATATACAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTCCGTACACCAGTCTACTTGTGTTTCACCTGGAAGACTGGTCACTTCCAGATG
CACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCCAGAAGATAACTTTCAGATATATCCAAAAGGAAAACCACTTCCGGATCACTC
AATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGGACTACTAACAACCTCCTGAAACGGCAATTACTATGAAATGGGGGTCTAGAG
GACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAATGCGCGTCACTCGGTCACCGCCTAATTTGGTCTTGAGCCTTTCGGAGAGTTCCA
CGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTGAACCCGGGTCCCCGGAAATACACGGCGGCTTGTCCGGCGTTATCCCAGCGTGCTTC
CAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGCAAAACGAACTCTCTGTTATTTTTAGTCTCTGCTAGAAGTCTTCTGTCAAGGTC
TCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAGGGTTCTTTGGCGTAATCAGCATCCGGGAGGCTGACACATCCTGGTCGCAAGCC
GGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCGCTAATATCTTGGGCTTTGTATACTGGAAAATTGGAAAGGTCTTGGTGGGTACAAA
TCAGGGGGCGTCTGGTCAGCCTCCGCACCCACAACGTCTGGGTCATCTGCGAGTCACATCAGGAAGGAACTTTCGGAAGGCACACGTGACTTCCGGAAGT
AACTCGACATTGGGAGGACTTCTGGAAGTCACTTGGTCTCAGTATGCTGTGGGAACTTGTACCAGTTCTCCGTTCGTCCTCGTTCTTCCCTGTCGCGCGC
ACTTCTGGACCAATCATCACCGCGAGTGCTTCCATGGGAAATGGGAAACGACGCTCGGACATTTTACGTCCAGTCGCCACGTGTCAACCGTCCCTCTCGT
CATAAGCTTTCATAGAGGAATTTGCTTTCCCCCCGAGCTGACAGGTTGTGATGAGATCACACGTGCCCAAATTGACCAGGGTATCCGGTCGGAAATCACA
TCCGGACGGCGGATTGGTCCTTCAACTGGCGGAGGTCGCTTCCTTTCTTCGCCCTGTCCCGGATCGTCCAATCACATCACTTCTTGGCGGTCGGAAATCA
ACGTCGTCGAAGCGCGATCAAATCGCAATCTCCCGCCTGGTGAGCAACAGCATGGCTCCCACTGGCACTTCAGGTCCTCCTGCAAGCTCCGCGCAGACGC
CTTCGGCGTCCCCTGGCGACGGCAGCCCCAGTGGGGGTGATGTCGCTGGCGAGTCTCCAAGCGTCCCTTCCCCAACTCCGCCGCCCGTCGATGACGAGGA
GGAAGAGGTGGAAGAGGAACTTCCGGAAGAAGAGGAAGCTCCCGATGACGCGGCGGATGAGTCGATGGATGCACCTTCGGGACGATCGTCGGCTCAGACC
CCCTCTCGGTTACTGCTTTTGGATCGAGCACTTGCTCTCCAAGGCGAGAGCGCACTTCCTTCCGGACGTGACATCCCGCACGACGTCAGTTGCCGCAGGC
GCGTTATGAAGTCCCTCCGGAGCACACTTCCGGTAGACAGGTCCGTCTCGTTGGGTTCCGCGACTGAAAGCCACAACGATGGGAAAACGTTCACCCAGAA
CGGCTACGGCGGTCTGGAGGCGCTAATGCAGATGAATGAGTTGACCATCGGTTCTCTGGCGCAGTTGTATGATTTCTTCGACGAAAATGTGGACATTCAC
GATTACGTCTTGACGCCCCGCAAGAAACCACTTTCGGAAGATGACATGGAGCACAGTTGGTCACGTTGGTCTGAAGCGCGAGATCGCGAGCATTCTGACC
GAATTTGGTCCGGAAAATTTGGCTCAGCGGGTCTTTGGGACAGTGGACGTCCTTCAGAAGGTGATGGCTCGTTATCGTCGGGTGCGAGAGCAGTGGACGA
TTCCAGTTCGGCTGTCCACGACGCCGTCGAAGCTCGTGATGAACTTCTGGTGGTAAAGCAGGACTACCAGTTCCAGACGGACTATTGGAGTCGGAAGGTG
GCCGAGGTTCTGGCGGAAAAGGACGAGGTCGTCCGAAGTTCCCGTGAAGACATCATCCAGCTCCTGAAAGAGCATGCTGATGACAAGCGTCACTCAAGGA
ACAAGTGGCCACGCTCACCCGACGTCTGGACGACTCGGAAGCGCATCGCAAGATGCTGAGCGACCGTCTTCGACAGACGCGTCTGGAAGTGGCCGATGTG
ATGAACTTCTTGAGTGACCACTCGCAGCTCTACTTGAACTGGCCTCGCCTCCGAGATCTCTTGGTTCACTTCCGGAACGGCACGCGTGTTCCATCTGGGT
GGAACACCATGATCACGGTCGTCGCAAATGACGACCCGAACTTCGCACCGACGTCTTACACTCGGATGAACCGTCCTCACGGCGACGATGACGGAGAGTT
CAAGGACAGTGGTCCTCCTTCAGACGCTCTGACCGTCGACCTGACGCAAGACTCATCTTCAGGTGTGCCTGGTGGCAGTTCACCCAAGCGCAAGCGGTCT
TCTGGAGGCAAGTCACGTGGTTCGTCCCGCAAGGTTCCAGACGCCATCCAAGATTTCCCGTCCGAATGGGACCGGACCTCCGATGAGCAGTGTCTTCAGG
ACACCAGCAACATCTCGTCGGAGCAAGATGCCCACAAGATGTTGGCTGACTTCCCGGTGGTCTGGGACCAACTTCGTTTGGACGTCCAGATGTTAATGCG
GTCTGGCGTCGGGTACTCGGGAGCGGTTGAGTTGCTCGACCAAGATCAGGTCCTCCACACCAAGTTCCCGCTCGACCCGCTTCTGGAAATGCTTGTCCGG
ATGATGTTCTGGAACAAGCTGGACGAGACACCGTGGACCAAGCACGTCCCGAGACGCTACTTCCGGGCGGCTCGTGCGAAGCTGGACGACCTTCTGGAAG
ATGATGTCCAGCCTCCAGTCTGGGACGCTCTGATGTCGCTGGACCAGGAAGAGGACGACCTCATCCCGGAGGTCTTCGAGCCGGAGGTCGATGACAAGAC
CAAGGATGGTGACTTCGTCCCGGGTGAGGAATTTGAGCTTCCTGAAGATGAAGTCATCCCGGTCGACGAGTCTCCTCCCAAGCGTACCCGTCAGAAGTCC
AAGCGTCGTCGCACAAGTTCGTCGACATCTGGATCTACTCCTTCCAAGAAGCCCAAGCGTTCCAAGCGTCGGAATGACCTGTCCGCTACTGACTTGGCCC
GGAAGGATTTCGAGTCTCTGACGTCCTTGGAAAGACGATCATCGAGACGCCTGGTCCGAGCATCACTTCTTGGATGCACTTGGGCATCCGGGTGAAAAGA
GGTGATCCGACCACGCTCTCTGCCCTCCAGACGCCGGGCTTTCCAGACTACGCTCCGAACCGGTTTGACTTGGACCTCCTGAAAGAGCGTTGCGACGGGC
AAGAACTGGGTGCCTTTCTGAACACCATGCCTTGGCGCAAGATGTTCGATGAACGTCCGCGTGAATTGTACTTCCACAAGCGCGAAGATCTGGATGACGA
AGTGCTAAATGCTCTTGACGACTGGATGGACTTCGTGTGTGGAAACTTCCGGGCGATCTGGGACATCCTGCATTGGCTCACGCTGGATCGCTCTTCAGAT
GCACCGCCGGGTATTCTCAAGATTCAGACCAAGCGCGCTCGTCGTCATGAAGGTTTCCGAAAGAAGGCCTTGGCACTCCAGAAGAAGTTGTCCACCAAGT
TGCCGTCTACCATCTGGAACGAGCCTGGTGTTTGGAAGTTCCCGAACAAGATTTGCCACTGGATCCTGATGGACAAGCAGCACTTCAAACCAGGGACTTC
CGAATGTTACTCGTTGCAGGAGCAGATGGAACTTCTGGACCGCCGTGAGCCTGCTCGCGCGCAATGGAGCTTCTGTTCCACGGATGCAGAGCGCATCGCC
CACCTCCCGGAAAACGTTCGTCGCGGTCTGATTCCTGCTGATGAGCGGGATCCAGTCACTGACATCTTCTCTTAGTCTTCCATTGGCAATCCATCCGGAC
GTCGTCACACATCTGCACGTTTTTCTCTTCCAGTAGTCTCAAAGTTAATCGTCCGAAATATACTCACTTGACTTTCCAAATGTTCCCAATCACAACTTCC
CATAGTATCCACTTCTCGAAATTCGCCACTTACAATACACACTCGATACTCACTCCAATTTCACAGCAATATAATCACACATTTCCAAAAGTCCGTTCGT
CTGATCCATCCAAAAGGATGATATCTCGAAGGCCTAAACTCTTGGATGGTCATCACCTGCTTGCATAGTTTGGAAGCGAGCTCTCGCACGTGCACCTTGG
TTGAATTCATAGAGTAAGGCACCACAGCTCAGTTGTGTCACTGGTAACCACTCGGGTTCATCATAGCCTTTCCACTTGATGAGGTACTCTCGGCGCCGCC
TGGAAGTACGAGTACGTTTGGACCAACGTAAGTCCAAAATCTTTTCAACTTCGTACTCGTCCCTTCCAGCATCCGGTTCCCAACTGTCTTCTGGAAGTAG
TGCAGCATCAAAGTCGTCATCTTCGTTCACGTTCAACTCCATATTCGGGCGTTTTGGAAATAGAGCCCGGGGCTTCAAACGACTGATGTGCACCCAAGGG
TTGACACGATATCCGGTGTCCTCGATCTTGAGCTTCACCCTGAAGTCATCATGCACTTCCTCAATTCGGAAGGGGCCATGCCACATGTGGGCCAACTTTC
TGCTCAGTCCAGGTTGGACCTTCGGATGTACAACCACACCAGGTCACCCACTTCGAACCCGGACTTCAGTCTGTCGGAAAGTTCTTTCCACTTCTGCGTT
TGCGCATCCGAACGGTGACGCTTAGCTTTCTTCTGTAGGTCTTCTGCACATGCTTTCGCATAGCTGTAGTCCCGTTGAAGCTTTCGTCGCCACTCATAAG
CGGTCCTCTCCTGAAGACTTGATGGCTTCGGACCCAACATTGCAGATAACGTCCCTTGGGCATCCCATCCGTGAACCAGATAAAATGGCGTGTCCAGGCG
AGTTGCGTCGAATGACGTATTCAGAGCGAACATGAGTCTTTCTGAATGATCGTCCCAATCGCTCTGATCCGCTTCCGAAATGTACGCTCGGATGCTCCTG
ACCACCGTCTGGACGGACGCTCCTGTTGGCCATTTGCCTGGGGACGATATGCCAGTGTGGCGCGCTGTCGACTTCCTAAAAGTTCTCGGAAGCGGTGAAC
ACCTCGCTCATAAACCTTGGGTCTTGATCGTGACGCAACATCGAACTTGCTCCAAACCTTCGGAAGACGCACTCTTCGTAAGCTTCCGCTACGTCCTGAG
CTGTCGTCGAACTCATGGGTTTGCACATGACGAATCCGGAAAACGTATCTTGGAACAAAAGTAAAAAGGTGTTCCCACGCTCGGACTTCGGCATGTGCGT
CACAAAGTCCATCGATACAACTTCGAAAGGTCTTCTAGGTTCGATGTTTCCAGGCGACGGACCAGCATTCGGAGGTCGTCCCTTGCCGCTGGCACAATCA
ACACATTCCTTCACATAGCGTTCCACATCCGCATACATACCAGGCCAATAGAATTCCGAACGCAATTTCTCGTGCGTCCGAGTGATGCCTTGATGGCCGC
CCTGATAATCTTCGTGCGCATAGTGCAGCATATCTGGACGGAGTGACTTCGGGACGACCAGCCTTGGCTCATCCACAAAGTCCCTCGGGCGGTCTCGGGT
AGATCGTGCAAGTCGGTACAGCACATCGCGAGTGTCGAGCGCAAACAAGTCAGCAACTTTGGCAATCTTTCGGAGGCGTCTGGGTGAGAATCTGTCAACT
TCACCCTTCAGGAAATCTTTGATCTCTGACAAGTACTCGTCTTCTTCCTGATGAACTTTGATGCGACGCCATCTTTCCGCTTGGAATTCCAGAGGTCCCA
TTGGTGGTCCATCCAGAGATTCGGTGGTTTGAAGGCCTGACCTCGTCATGACTGCCATCACTCTGGCGGCTGCCGACAACGGGGCAGAATCAGCATCAGG
AAGCACCGTTCCTACCTGAGCGTCCCTCGCATCCGAGCTTCCGGGTCCCACTGGACTGGAACTGTCATCGCCATCTGGAGTGTCAGTCTTCGTGACCTTT
TCAGGTATTTTAGACACGACTTCCAGGTGTCGGAGCTCATTTTCATCTTGGACTTCCCATGACTCACCCAGTAGCAACGTCTTGGAAGTCAAGTAATCGG
CGGCTTGATTGTACTCCCTCTTGAGGTGTGCCAGCCTTACCGTTCGGAACTTGGCCTTCAGAACATTAGCCTCCGCGAGATGCTTTTTGCAGGTGGGGCT
GATTGCAATTGATCAGTCCTTGCACTTGCTGAATAACAATCCGGGAGTCACCGACCACGAATAGATCTTCGACTTGACGTTCGGAAGCCATCGCCATACC
TTTCAGAAGTCCATAGTATTCAGCGTCATTCACAGTAACATCTTTCAGAATATAACCGTGTGCTTCTAGAACGGTCCAACCGGGCACCTTCCAAAGGATG
CACCCGCAACTTCCTTGACGAGTCGACGTCTTGGCAGCTCCATCGAAACGAAGGACGATTCCATCGTAATCTGCATCAAACATCTCAACACTCACCACAG
GCGGCTGCCGGATCTCCCCTTTCGCTGGAATCAGTGATTCAGCAACTTTGTCTAAGTGTTCACGCGGAGTGATCCCAGCGCTCATGATAGCAGCCAGACC
GTCCTCGTCCCGTTGAACCTTCCGGATTTCCATGTTCCACCCGGACAACGCGAGTCCCCATGGGACGCATCTTCCGTCGGCGGATTTAGAAGTGATGACC
CACTTCAGAACGGAGTACCTTGTGTAGACGATCAGTGGACAATGTTCAACGATCGTCCGGAACACCTGAAGCACCTTCATGATAGCGATCACTTCCTTCC
CGGCGACATGATACCTCACCTCGGAATCGTTCAGGACGCGGCCGGTATATCTGACTGGGTGTATCTTCCCATCATATTCCTGCCCGAGGACTGCGCATGC
AGCCCACTGATTGGCATGCGGAATGATGACAAACGGTCGGGAGCGATCCGGATGGCGTAGCAACGGAGTTGAGACAATCTTCCGCTTCAGGATTCCAAAG
GCCTCCTTAGCTCTTGATAGATTACGTCCCGAGCGCACTTGGTCATCCGAGAGTTCATACAGAACCGCAGCTACCACTGGAAAGTCCTCAATAAACTTGT
GATAGTAATTGAGACTTCCGAGGAACGATTGTACTCCTTTCAGTGTGCTTGGGAACGGCAAGTCCTGAACGCCTTTCGCAATCTTAGGTGTCGCCCGGAT
GCCTTCAGCACTGATCTCGTGCGACAGATACGGGATCGACTTCTTTCCGAACTCACGTTTAGGGAGGCTCACGGAAATATTCCAGTACCTCAACCTGAAA
AGGAGTGCGTTCAGATCATCACAAAGTTGGTCCCAGGTTTCAGCTCCATGTGCAATGTCGTCGATATAGGAACTACGTCCCAAGACAGGGCCCATCTGAG
ATGGTGCAGGGATATTCCTTTTGAACACAGTCATGTACTCAGTCAGCGTCGGGACTTCAGGATTAGTGTCCTCATCCAGAAGATTGGCTTCCGGAGGGGG
CAACTTCAGGAAATCCAAGACGTCTTGGTCGACTTCAGATTCTTCCTCTGGAGGCAGCCGAAACGAATCCCCACAGGCAGTTATTAATTACTGCCTGATA
CACCAAAGGCGCGTTTTTGAGCCCAAACGGCATTCGCACCCATTGGAAGTGTCCAAACGGACACACAAAAGCCGAAATCAACTTGGCGCGCTCTGACATT
CGAACCGCCCAGAATCCACTAGCCATATCCAAGCTCATGAACCACATTGCGTTCTCAAATCCGATCAGTAAGTCGTCAATCAGCGATAACGGGTAGTTCG
AAAGTTCGATAAAACCATTGACGATCCGGTAATCAATACACATCCGGATATCCACACCGTTTTTTCTTCAGGACAATCACGATCGGAGAGGACCATGGTG
ATTCGGAAGGTTCGATCAATCCGGTTTCCAAGAGTTTCTTGAGTAACTCATAGACCTTGGTAGCCAAATGGGGTGCAATGGATCGGGCGCGTTGTGCGAC
CGGCTTGGCCGTCCCAACGTCCAAATCACAAGTCACAAGTCACTCCTCTTGCTGGAGCAGGAGCAGCATTTCCGTCACCCAGAAAGATAGAGCGGTGGTA
CTTCAGGATGGACCGAAACTTTTGCTCTTCCCAGAGGTGATGTCGTTTCCGAATCCCCCACATCAGCCGCATCAATATCACATGTCGGGCTCAACTCTTG
GAGTTCCGGAAGCATCGCCAGCTGATCACGCAATTGGGCTAACAAGTCACTTCCTTCATGAATGTACACAGCGGGTTCCAAATCTAGTTCTTCTGCGTTC
AGACGCATTCACCTCTCATACTCAATTTCCAACTTTTGGATTGGGGTACAGAACATGGCTTGGGTTTGCTGATCCCGGAGTTCGTCTAATCCTGACAAGT
CGTCCAGACAATCGTTCACATCGTCAGCACCTTCATCCGGAAACTCTTCATTCAGACTAATCGAATCAAAGAATTCATCTCCGTCCGAATCCACGTCGTC
TGTCAGTAGTTCTACGTCTTCCAAACGTTCTTCAACCCTTGGTATGACTTCCGACTCCCTTGGATGACATCCGTCGCCGGTATCTTCCGGACGTGGCATT
TCCTCAACCTCAGGGTCCTTTTTCAGCTTTACCGTGTCTTCTGCGATGACTGCATCTGGAAGAGTTTCCTCCACTTTCGGGCGTAAGATTCGAGGCAGCT
CCTGAAGTTGCACCATGTGAACTTGGTCGCTTCCAGGAAGCGGTCGAATCAATAACTTAGTCGGCCATGAGTACTCGGACTTCTGGACGCAAGGAGGTTC
GGCGTCCCTCATCATCTGCTCAAATCGTTCAGAACGTAAACGCATCTGATTGGATTCGGTATTCTCATAGATGAGAGTCTGCCACTCCTGATACCTTCGG
AGACCCGGGCGGACAAAACGTCCTGCCCTCGGGAAGAAGCCAAACTCGATGATCCGAGCGTCCGAGTGTCAATGCTAAGACACCTTCCGGAAATGTTCAC
CACTTTGATGGCCACAGCCCACGATCTAGCAGCATAGATGATCTGAGTTACCCATCGATCTCCCCGACCAGCCCATACCACATCACGTTGTGGATTGCTC
TGTCCGTAATGTATCCGGACGATTGCATGTTCACCTGGACGCAGGAAAAGCTCTTCACGCGGTCTCACCGGAAGGTCCAAACCTCTGTGGTAATGATCCG
CACCACGTCCTGATAGCAACACAGTTTCTTCATCCGGAAGTTGCACCAATCCTTCTCGTGCGCACAGTCGCACTCCAGCGGAATACATGAAATTCATTCC
AAGCAACACGTCGACACCTTCACCAATGTTCGCGACCCAGAGCTCCAAGACATACACAATTCTTGGACCTAAAGTGATTTTCACTTCAGCACTCGCCGTG
ATGATTGTCAAAACGCCACCCAGTCCAGATACCCGGAGCTGTTTGCAGAAGCTTAGTTTGAGTTTGAGTCTACGCGCAAGATCCAAACTCACCATGCTTT
CTGACGCTCCGGAATCCAAAAGGATGTCTGTCCGGCAATTGTTTACCGCTCCATGAACCATCGCAATCCGTTTCGTGTCATCCAAACAGTGATCTTCCCA
CCAGCCATATCGTTCGCCTGGTCCCAATCGGAATTCAACAGGTACATCCGGATCTTTTACTTCCGGCCGTACACCTTCCGACAGAACTCGTTCAGAACGA
AGTTCGTCTGAAAGAGGGTCACCACTTTCCGGAGTCACGGTCATGCATTGAAGTTTATCCTGTTTTTGGCGTCTCAACTCCGGACCAACATACACTAGAA
GACACATATTGGGGGGTTTCTTCAGACCGTCGCGTTATGGATCCCCATCCAGCGGGCTTACTAGTTTAACGGCTGTTCCCCTGGATCCACCTTCCCTTCC
AGAAGTTGCTTCCGGATAGGAGACGTGTAGCGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCACT
CCACAGGATGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATAAGAGTCATTCAATAGATAGGGGTTCTGCCAGC
CATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGT
TCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTT
AAGTAGTGGGTCTAAGCAGACCCATTACAAGACGGCAGATCTTTCAGTGCTCCTTGACGTGCAAGATTCTTGATCGTTTGGAAAGCTTTCCATTCTTCAC
ATTTGCCTTCGTGAAACTGGTTACAAATCACACACGGACGAGTCCTGCAGAGGTGTGTCGGATGTCCCATCCGATGGCATCGATCACATTCGATGTCCGA
CCAACAGTTATCCGTTAGATGTCCAAACTCCTTGCACTTGTCACAGAACTTGGACGCGTTCGGACTTCCAAAACGTTGCTGCAGGCGATCCGAACGGAAA
TCAGCAGTCGGTGGCCGCCATCCGGGATTCTCCATCGCACGAAATACTGCTTCGGAAAGGTTATCCATGCTCGAACCGGACACGTTCGTGGCATCCGCAG
TTGGAGTAGTCAGCACACTCGGAACATGTTCTCGACTTGTCACTTCTTCCACATCTTCCAAAAAATGGACTTGTCTGTCGTGCTCGCCATCCCGGTTATC
GTCATCGTGAAGAACATAGGATCTTCCAGAAACGTTTCGGTCTGAATCGATCACGAGGGACATTGTCCGCTCGGAAGTCTATCTTCGGAGGTGGAGTATC
GTAGTCGTCGTCTTGATTCATTTCTTCATGCTGTTTCAGGACATATTCCAGGTCCTTCAGACGATGCAGACGTTGTCCTTGCAAAGTCGTTCGGAGGCGA
GAGTCCAGAAGATTCTTCGTGAACACTTTCAGATGGCGCTCACGTTGCTTGCTCGATGCATCGAACTCGATCCCAGCATTGTCGGCCACCTTGTTCAGGC
GGTAGTAAAATTCCAGCGGGGATTCTGCCCTTCTTTTGGATCATCGTGTAGTAGCGTTCTGAATCCGAGGTCTTGGCCTTGCAATACATATTTCGGAACT
CCTTCAGGAACTTCTTCCATTTCCGGCGCACGTTGGGATTCAAGTTCGAACGCCAGTTCCGAACGGCAGCAGGTTACTTCAGCTTCATCTCATAGATCTT
GACCTTATCCGACCAACCACCCTGAACGGCAAAACTCTTGAATCGTTCTAACCACCGGATACGTGTAGCTGGTGACGTCTTCTCATTGAAGTCTTCCAAC
GTGCTGACATTCACGTATGGTCTGAACGTAAACAGAGATCCGCCTGGACCCGGTGTCGTATGGACATTCGGAACGACATCTTCGAAAGAGCTGCTATTTG
AACTGTCAGAGTCAGAGTCACCCCTACTGGAGTCAGAACTTGGATCAGAATCCGAAGGGTCACTTGACTTTCCTGATGACTTCTTCGTCCACTTCCCTTT
TCCGGAAGCCGAACTTTTCTTGGACAAACCAGACTTTTCGGAAGTGTGTCGCTTGGCTGACTTTCCGGGTGCACTTGACTTGGTTCCAGAGGACGACTCG
GCCTTTCCAATTGCAGGCGTTCTACTTCCAGATATGGGTTCCGCTTTCATGTTCACAACAGGCTCAGAAATCTTCACAGCTTTCCCCATCAGGTTGTTCG
AAACTCTGTCAGCAGCAAATGCCTGCAAAGTAGCTTGCAATTG