Description :
From Genome Similarity Track
Location :
Scaffold_59:46879- 48025
Transcript NameFunction/comments
Sapdi_VS20SDRG_13357serine/threonine protein kinase

Sequence
1146 bases(100 bases per row)
CCTGAGTCGTTCGCGCCGTTCGTTTAGGGAGCGTGAACGAATGTTATCGCACCGCGGGATCTTGCTTGCATCCCAGGTGGCATCCGCCGTCCGCCAACGC
TACGTATCGCAAGCCTCGTGGCTTCGAGTCCCGCTGGCGCTTCGATTCCGCCGACAATACATACTATGCTATATACGTGTGCTTTGTGTCTATGCATCGT
GCTTGGTGCTTGGTCCTTTGCGTCATCGCACTGCAGGCATCAGTCGCGCTTCGCGTCGAATCATTGGACCAACATTCGGAATGACCTGGGTTAAACCCAT
GCGACGTTAAACGCTGAGTCCGAGCTTGGAGGTCGCGTTGCATTGGTCCGTTGGCGGCGTCTAAATATACGCGCCAATCAGCGCAAAGTATCAAAAATAG
ATCGACCAATCGCCGTGTTGGATGCGTTGGCCCAAGCCACCCAATGGCATCGAAGCCGGACGCCACGGTCGCATTCCACAAGAAGCCGACGCATGGACAA
GTACGTCAACCGCCGCCTGCTCGCGCCCGCGCTCTTCGGCGACGTGCTCCTGTGCACGGACGCCATGACGCACCGGGACGTGGTCGTCAAGGCCATGGAT
CTCGACCGCGCCGCCGCCCACGCCACAACCGACGGCCTCCCGGTATGCTCCGACATCGATGCTGGCGACGTGCTCACCGCGTGATGCTAGGTGCACGAAG
ACATCACGATGGAGAAGCGCGTCTACACGCAGATGCAGCTCCACGGTGGCCACGCCAACATCCTCCGGCTCCTTGCGTGTTTTGAGGCCGACGGCCGAGA
CCATTTCGTGCTCGAGTATGCGAGCCGCGGCGACCTCTTCTCGCAGCTTCGAACGCAGCAGCGCTTCCGCGCCTATGAAGCGCGTGCGTACTTTGGCAAC
ATTACCGCCGGCCTCGCTTTTCTCCACGACCGTACGTTGTGTGGCACGTTGCATTCAACACTCACCGCGTGACTAGATGGCTTTGCGCACGGCGACCTCT
CGCTCGAGAATGTGGTCGTGACGGCCGACAACACTTGCAAGCTCATGGACTTTGGCCTGGCGTCGGCGCTCGCTGACGGGCCACGGACCGTCGCCGTCGG
CAAGTACTTTTACATGGCCCCCGAAGTGTTTCTCGGCCAGCCGTAC