Description :
From Genome Similarity Track
Location :
contig_28:468770- 470025
Transcript NameFunction/comments
g6666.t1RAW42825.1 hypothetical protein PC110_g1003 [Phytophthora cactorum

Sequence
1255 bases(100 bases per row)
CCGCCCAGGAACACCGGAAGTTTGTAGCCGAGCGAGGTGTTCACAATGGCTGTACCGATGGCAAAGTTGAGTAGCTGGCCGAAGCAGTTGGCCGAGTTCA
AGGCACCAACGTACATGCCGATCTCTACATCGTCACCCATCACGTGGATGATGACTGGCACAATGCAAGAGAACCACACGGAGGAGGTCATGCCGCAGAT
AGCCACGACGAACACGTCGAAGCCCTTGTTGCTGACCCAGGCCATGACGAGCAGGAACATCTGCGGAACGGTGGACATCGTGAGCACCCACTTGAGACCG
AGCTTGCTCACCAGGAAAGGCAGACACCACGAGTAGATGTAGCCGACAATGTTGTACAGCAGGTCAGCAGTTCCGCCGGCAAGGCTGACACCGTCGTTGT
AGGCGTCTTGCTCGGCCGTGCAGGGGTCGCAGCTATCGGCGTTCGCGGAGGTTCCGCCGTACACTTCAAGGCCGAAGAACTGTCCCTTGTTGCCGTTGTA
GGCCGTGTAGCCGTACTGCACGAAGAAGAAGCCGACGCCGTAGATGACCAGCACCTTCGGCAACGTCTTGATACCGAGCCAGACAGAGTAGAAGGCGCCC
TTGACCTGTGTCCAAGCGGAGACCTGCTCCACCTTGCTGGGGTCGAGAGGGGTCTCGTGGGCGAAAACCGTCGCGACAGCAACGCACACGATCATAATGA
CAGAAAGCGTTCCCATGAACCAGTGCATGGTGAGGTAAGCCGCGCCGAACGCGTCAATGTAGACGGCCACCACAATCGAGCCCAGTGTCGACCAAGCCTG
ACCGAGAGCAGCGCCGGTAGTTTGGCGGTCACCGGCAAAGTCGGCGACTAGAAGCATGGCCGGCGTCTGGACAATGTTGACGGTGATGTCCATCCACGCG
TAGAAAATGGTGAACACGGTCGTCCACATGCGATCGCTGTCGGCGCTCGATCCATCGCCCGTGTCTCCGAGGAGGTCGCCAATTTCACGCGTGTAGCCCA
TGGCAATCCAGCAGATGACACTGAGGATACCGGCGACCACCAGGTAGGGGCGACGGCGGCCGAATCGAGACGTGGTGCGGTCACTGAAGACGCCGATACT
GGGGCCGACAATGACACCGACGATGGGACCGATGAACTGCGTGGCTTGCACGGCTGAGTTGGACAGCATGGTCGACAGGTAGGGCCCCAGAGCGGCCCAC
TGCGCGGACCAAGCCATGTTGATAGCCATCCGCGGCATCGACACGGCGAGCAGCA