Description :
From Genome Similarity Track
Location :
Scaffold_66:46876- 49203
Transcript NameFunction/comments
Phyra_81938Rio kinase putative
Phyra_96152AlNc14C6G905

Sequence
2327 bases(100 bases per row)
CTTGCGAAAGGATTGCCGCAACATCGCCGACTACTTCCGCAAGACGGGCGCGCTAAACCCCATGACCACGCAGGAGCTGTTCGACTTCGTTACGGACCCG
CGCATTGCTGACGACGACGTTGATGAACACCTCGAAGCGATTCAGCGCGTAATCGCTGAGCGTCCTGTGGAGCGTACAAACCAGGAGCAGGTGGACGAAG
CTGTGTTCATGAGCACGTTCATCCCTCGCTCGCTGGGCGAGGTGTTGCACTCGGAGCGCGAACAACTCGCGTACCAAGCGGGCACCATGGAGAAGGCGTT
GGTGACGGCCATCTCCCGTCTCGAAGTTGATCAGGGGACGACGCCTCCTCCAGCCATGCAGGGCACGCGTATCATGGATCTCTTGAACGAGGAGGATGAC
CAGGAGCTTGGCTCGAGCGACGAGGAAGATGATGACGAGGAAGAAAGTGCCAGTGGTGACGAGTCCAACAGCGAGTATGAGGAGGAAGAAGAAGATTCTC
TCTCGGGTAAGGTACCGCTGACAGACGAACAACGGGCGGCGTATCGGCAAGAAAAGCGCGAGGAGCGCGAAAAGCTGAAAGCTTTGGAAAAGCAGAACAA
GAAGGCCCGCAAGCAGGAGGTGAGGGAAGAGAAAAAAAGCAAGCGGCAGACGAAAATTCCAAAGCACGTCAAGAAGCGTCACAAGAAGCTTGCACACCAG
AAAAAGTAATCTAGCAATAGAGAACGCAGTGGCGTCCATGCTTACCCGTATTGGAAATGTGGTTTGCGTTTGCTTCTTTGGTGTCAAATGCGGATTCGGT
AGCTGTCGGTGCAAGAATTCATGCATCAAACAGCAGCGTTGCGGGAGGACAAGGTGCCAAGTAGAACGAACTCCTTCCAGTTATTGGACAGGAGTGCTTG
GATGTTGCATTATACGCAGTGAATTGTCGAATAATCGTGGCTGGTGGCGTCCTTGATGCTGGATGGCTTATCAATAATAATAAGACAGCACTTGCGCGTC
TATCCTGCCCTGGCTCACGTATTAATCAGCGTCGCTGTCAAGACGTGTTTGCATCCTCGAATGACGGAGAAGAAGCACACTTGAAGTATAAAACCGGGCA
CATCATCTTTCACCACGACAAAGCAAAACAAGAGACGCGTGATAACACAGTTTGACTCACTGCAGACCACCATACCTTTTCACCGGAAGCGATCTTGACC
CCATCTCGAATCTTCTGCCATGCTGAGGGAAGAATTGCCGTCAGCATTGTAGTCACACAGCCTTCGCCAGCTCCAGGCTTCGCTGATCAAACGGGTAACA
TTTGGCGCGCATCATCCTTTTGCTGGCAATGAACGCGATGAGTATGAACGATGAGGGTGTAGCGGCTGCAGTCATCCACCCACTTCAATCGGATCGAGTT
CGCCATTCCTTTGTCAGTGTCAGAGTCCCTGACTTTATCTAAGTCAAGGCAGCGAAGTTGTCTCGCTTTTCTAATCCCATCGTGTTTGAATGCGTTGTCC
TCAGCGTTTGATATCTCCAACTCAATCTCTTAAATAGCTCGTGACGTTCTCAACCAAATCCGCTGTTTCATAATAAACCTCGCACTGCCACTTGTGGCCG
TGTGACCTAGAAACACAAACCCGTTAGTGAAGCAAACCTTGAAACCTTAGCCAACTTTACTCACGTGGGTTTGAGCCAGTCTCATCGTTGCCATGGAGCT
CAGTGCTACAGCTCTAGTGCACAGAGAAGTCGCAGCCAACAACTGTGCCGCCGGCGGGCGGCGAAAAGTTAAATAACGAGCTGCAAGAATGAACTTGCTA
GATTGTTGAGACCCGTTTCTACTTTGTAAAAGCTACTATTCTTCCGCGTCATCAATCGCAGGAGAGCCCACACCTTCTTCCTTCTGGTAGTTCTGGGGTT
GCTGCTGCAACAGATCCGTGCGTGTGGAGTGACCACCACGCAGCATTTGGGCAGCCCAGCGACCAATTTTGCGACGGCGCTGGTGATACACAAAGCAGCA
GGTTAGTAAACGCACTCGCAAGTATTGCGAACAAAATCTTCCATGGAGACGTACATGGATGTAGACCGTAGCAGTTCCCCAGCTCATAATGAAGTTGAGG
CTCTTGACAACTTCGAACAACCCCGTACGCAGTACATGCGTCGTCGAGATGAAGAATGCGCCCTGCTTGAGCTTTTCGGCCGCCAGAGAAATCTGCGTCC
ATTCCCTGTCAACGACAGAAAATCTTGTCAATTCAACACCCTTTGCCCCTCTTCATGATGGCTTAAGCATTCGTACTTGTCATCGAAGCACGTGCCGTGA
CAGAACACAACGTCGCCATCCTCCCAC