Description :
From Genome Similarity Track
Location :
Scaffold_825:4686- 9312
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_825-fgenesh-gene-0.0RING zinc finger protein
Pytir_DAOMBR486fgenesh_masked-pir_contig_825-abinit-gene-0.23Aspartate carbamoyltransferase
Pytir_DAOMBR486maker-pir_contig_825-snap-gene-0.6Metalloprotease family M20D

Sequence
4626 bases(100 bases per row)
TGGCGCGATGGAGCTCGCTGTGCTCGGCGATACCTGCCCAATCTGTTTACAGGGACTTGATGACTCCGTGATGATCCAGGCGTGCTATCACGTGTACTGC
TTTGAGTGCCTAAACACCTGGGTGCAGAGTCTCGCGCTGCACGGCATCGATCCACCGACGTGCCCGCTCTGCAAGGCGCAATTCGAGACGATCTTCACGA
ACGTAGCGTCTGAGCACGACTATGAGGTGTTCCGGTTCCACGGCAAGCAGCGGAGAGACAGCCACGCGATCACTCGACAGCGTGAACAAGGTGCACAACG
ACAGCAGAGGCTGCAGCGCCGGTCGCTCGTGTACAGGCGCCGCATGCGCCTCGCGAAGATCAACGGCACGCCTGTGCCACTTCAGGACACAACAGATTCG
GCCAATGATGCACAGGTGCAGTACCCCAAGATCGTGAAAGTGAGAGGCGAGTACGACGCGTGGCTGCAGCGCGAGCTGGAGGCGTGCATCGGCTCCGACA
TTGACCTCACAGTGCTTGTCTCGCTCATCCAGTGTTGTTTGGACAAGATCCACCGCAGCGACGTCGCGAGAGGGTACAAAAAGCTGGAAGTCGCGCTGCA
GCCGTTTCTGTACGAAGACGCAGCGATATTCGTTCGCGAGTTTGCGTTTTTCCTCGGTTCGCGGCTGAACATGGACGCGTACGACTCGGTTCTGGAGTAC
TGTTGCTCGAATTCCAACGAGTGCGCGACCGCATTGTGTACTGCTATTCATAGCGAATGAGTTTAGGAGTAGTTTGTACTCGTGTAATATGTAAAGAAAA
CTCAAATGGCACATAAAAAAATAGTGCAAAGTGAGGTGATGAAGAAAATGGTATTCTCTGGAATGTGTGAATTTTGGGTGTTTTTTTCAGGTGAGAGTTG
TGTCCAAGCATCACGCGTGGATGGATGCACCTCGCTTAGCGGTAATCTATTTCTTGCCGAGCACCAGGGCGAGCAGCGCCATGCGAACGTACATACCGTT
CTCCATCTGACGAAAGTACGCCGCGCGAGGGTCCGCGTCGACCTCTTCGGCGATCTCGCCGACACGCGGCAGCGGATGCATGATCACCATGCTCTTCTTG
GCGTTCGCGATGCTCGCCAAAGTGATCACGAAGCTGTCCTTCACGGCGTTGTACTCTTCCTCCGACTCAAAGCGCTCCTATTAAGCGGAGTGAAGCACCA
AAACAAAGTTCAGCCATCGCGCAAGAAACAAGAAACCAAGTCATTTCTGAGCACTTGATCACAACCATACCTTTTGCACGCGCGTGACGTAGAGCACGTC
ACTCTGGTTGATCACCGAGTCCAGGTCCGTGGTCTCGTGCTGCTTCACGCCACGCGCAGCCAATTCGTCAAAGATGTAACGAGGCATCTTCAAACTCTCT
AATTAGCACAACACAAACAAAACGCAGGAACCAACTGGGTTAGACACCAAGTTGGATATCCCTACAGTGGACCATGAAAAGCGTACCTGGGGCGACGTAG
TTGATGGTCACGTTGAAGAGCGCGAGCAGTCTCGAGAGCGAGTGCACGGTGCGTCCATTCTTGAGATCACCGACCATCGTGACCACTTTGCCCGACAGGT
CCTCCAGGTTGCGGCCGAGCTCATTGTAGATCGTGTACAGATCCAGAAGCGCCTGCGTTGGGTGCTCGCCGACGCCATCACCCGCGTTCAGCACAGGCTT
CTTGGTCGCACCAGCGGCGACCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGCGCAGCACGATCACGTCCGAGTAGCACTCCATGCAGCG
GATCGTATCAGCGAGCGTCTCGCCCTTTTTGCTGCTGGACGAGTTCTCATTCACAGGCACCACCAGTCCGCCGAGACGAAGCATCGCCGCTTGGAACGAG
CACGACGTGCGGGTCGATGGCTCAAAGAACACATTCGCGAGTAGCTAAAACAGACAATTGCAGCAATAGCGTCAGCTTCTGCTGCAGCTCCACATCACAT
AGGCACAGCAATGCAGCGAGGCGCGTTACCTTTCCCTTGAGAAGGTCGCACGCGCCTTGGCTCTTCACAATCGCTCGCATCTCATCGGCGACCTCCAGCA
CGCGCCTGATAGCGGAAATTGCACAAGAACAGGCAGGCTCAACATGCTGCGCGCGTCATGTAGCAAGCAGTAGTACATGAGGCGACTCACTTGGCGCTGT
CGACGCCGAACTGCTCGATGGAGAGGATGTTCTCTCCAGCCCACGATCCCTTCGCGTCCAGAGCCATGGTGGTGGTGTTGATGATGGTGAGCTCTTCGTT
GTCTGTTGCTGATGTCGAAGTTACCACCGCCACACGCACGCCAACTCGCCACACAGTAAAGAGCAAATAAAAGGAAGTTGCACGAACGTGGATACATTCG
CGCAACCTCTCTTTGCTCTACTGCGTGCCTTCTCTAAAGTACGGTATTTGAAACTTCTGGTCCCCGTCGAGTCGCACTTTACCAGACGTGTCAAACTCCA
AAAGCCCAGAGGCTCGAAAGAAAGTGGTAGCTAGCCATGAGCGAGGACAGCGCCAAGAAGATGAAGCAGGGCGCCGGCAAGCGCCTGAACGACAAGCAGC
GCGTGGAGATCATCCAGATCTCCGAGAACTCCAAGATCTCCAAGCGCCAGCTGGCCGAGAAGTACGGCGTGAGCGAGGCCGCGATCCGCAAGCTACTGCT
CAAGAAGGACGAGTTCCTCAAGCGCTACTACGACACGCCCGAAGAGATCCGCGACCAGCGGCTGCGCGGCAAGAACCTCGGGCTCGGCCACGAATCTGCC
GACGTGGTGCAGACGGCTGCTAACGGCATCGACTACGCCAGAGGTGCGGCGACTGTCAGCACCGGCGTACCGACTACATCTGCATACACCAAGAGCCTGT
ACCCTCCAGACGACCCGTGGAAGCACGGACTCCCTGCGCTTGCGGGTAAGCTGGCGCCATTTTTGAAGAATTTTGCGCAGGGCAAACCTCCACGCGATGT
AAACGCCGTCGCTGTTGCGATTGCTGCCGCTGGAGAAGCGGGTGATCCTGTCACTGCGGACGAACCGAGCGCCTCGAATGCGGCGATCGATTGGATTGGA
TTCTCGCGCATGCTTCGCGACATTCGCCGCGCATTCCATCGATACCCAGAGCTCGGCTTCCAAGAAGTGCGCACGCAGTCGTTCATTAGACGTTTCTGCG
AGACAACGCTCCGTATTCCAGGTAAGAACATCCAAGCGATTGCGACGACGGGTTTAATTATCGATGTGTGTTTTGAAAACGCCACGATCACGTCGAGCGA
CAAAAGAAAGCTCCCAGTTATTGCGTTCCGCGCGGACATGGACGCGCTCCCGATTGAGGAAATGAATGACCACTTGCCATACTGCTCAACGCAAAAGAAG
CAGCGCAAGGAACTGCGCAAGCGCAAGAAGCGAAAAGTGAGCAGCAGCATCGCGACGCCAGTCAAGGCAGACGACCAAGCGAGCGACGAAGCCGTCCCTG
AAGGATTCGTGACGCCTGTGCAGTTGACTCCACGCGCCCAAGTCGGTGAAGAAGCTGCACACGAGAGTGGAGATGTCGACATGGAGTCGCCGACGGCGCC
AGCAGCTGCGCAAGACGGCGAGGAGCTTGACCAAGACGCGAATGGAGGCTTCCCTGTCGCTGCACACATGTGCGGCCATGACGGCCACATGGTCATGGTT
CTGGGGCTGTGCGCGCTGGTCGTCCGCAATGCGCACTTACTCCCACAGGACACGTTTGTGCGATTCATTTTCCAGCCAGCAGAAGAGGGACCAGGTGGTG
CAAAGAAGATGATTGAAGAAGGCGCGCTCGACACCGTTGACGAAGTGTATGGTGTGCATAACTACCCATTCCCTCTCTACAGCGTGCACCTGCGTCCCGG
CCCAGTGATGGCGCACGAAGTCGAGTTCTCGGTCGACATCAACGGCGTCGGCGGTCACGGCTCGGCTCCGCAGCAGTGCGTGGACCCGATCCTGGCAGGC
GCGATGGTCGTGCAAGCGCTTCAGTCTGTTGTGAGTCGCTCGCTCTCGCCGACCGACACGGCCGTGCTCTCGGTGACACAGTTCCAGGGCGGCGAGACCA
ACAATGTGATCCCGTCGCACGTGTTTCTCGCAGGCACGATCCGCGACTTTGACCTGGAGGTGGCCGAGAAGATCAAGGCGCGCATGGAGGCCATTGTACA
CTCGACGTGCGCTGCGGTCGGCGCGACGGCGCAAGTGCACTTCAAGGACGGCTACGCGCCTGTGATCAACCCGTACGAGGAGACGCGCAACGTGCAGCAG
GTGGCAATGGACATTGGCTTGTACGTGAGCGAGCAGGGGCTGCCACTGATGGCGGCGGAGGATTTCTCGTACTACCTGCAAGAACGCAAGGGCTGTTTCT
TCTTCTTGGGCACGAAAGAAGACGCGGACGACGACAAACTTCGCGCGCTGCACTCGGCCCAGTACGACTTCAACGATAAGGCCATCCCATTGGGCATCCG
CCTGTTCCTCGGCATCCTGCAGTCGCGCTTCCAGTGCGAGCTCTACTCGGCCGAGGAGATGCAGGCGTTCCAAGTCGCGATGGAGCGCATTGCGCTCCCG
AGCACCGTGACGATAGTGTAAACGTT