Description :
From Genome Similarity Track
Location :
scaffold_1047:4686- 7856
Transcript NameFunction/comments
g10896.t1 reverse transcriptase
g10897.t1 hypothetical protein PHYSODRAFT_335121

Sequence
3170 bases(100 bases per row)
ACGGCGATCAAGTCCATTATCACGAGAGTGGCGATCTTTCGGTCGAGGATCTCGCAGACAATCTCGCCGTTGTCCCGGAGATCACGATCTCGACTTCGGA
AGAGGTCAGGATAGAAGATCTACAGGTGGGTGATCCAGGATCGGCTACCCCACAGGAGGTCGAAAACCTCCGGCAGATCATCTGGAAGAAGCGACATCTC
TTGATCGGCAAAGGAAATGCACTGCCGCCGGCCGCCAGAGGAGTTGTATGCGATATCGATGTCGGGAATGCGAAGCCAATCGGGCAGCGAGTGCGTACAG
TAGCGCCGCAGTTCCGCGAGAAAGTGTCAGATCTGATCAAGGGACTCTTAGCCGCCAAGATCATCCGACCTTCAACATCGCCTTGGGCATCCCCAATCGC
AGTGATCATCAAGAAGAACGGTGTGGATATCAGGTTGTGTATTGATTACAGGCTGGTGAATGGCCTTACGAGGCTAATGATCTACTCGATGCCCCTGATC
AACGATCTACTGGAGGATCTCGACAAGGTTCTATGGTATTGCTCACTGGATATGGCAAGTGGATTCTGGGTTGTATCGATGACCGATCGAGCTCGCGCGA
TCTCGGCGTTCATCACTCCATTCGGTCTGCTCGGGCGGAATCGCATGTCTTTCGGCTTGAAGAACGCTCCCCAGATCTATCAACGTCTCGTGGATAACGC
CTTATACGGATTCCTGTTTCGCGATCTGGTGACTCAGAAGGCTTAGTTGATGTGTTCGAGTCACGGGTCCCAAAAGCTCCGGGTCAACCATCGGTGCTGG
GACGTAGATCATACATCGACGACATTCTAATCATCGCCGGATCATAGGTAAGATGTGCCAAAGGGTGGAAGATCTACTGGAAGCCTGCTATAAGTGGAAG
TGTGGTAAAGAGCTTCTGGGGTATGAGTAAAGTGGAGTATCTACATAGAGTGTCGATCGAAGGTCTGGAAGCGAATCCAAAGGATCTAAAGTCTATGACT
GGTCTGCCATTTCCTGGATCACTCCGGTCCATGTAGTCGTTCTTGGGGAGTTTGAATTACTACAGCTGATTCATCGGAGATTACGCAGTCTACGCCTCGG
TTCTGTTTGAACTACGTGAAGTGGAGTTCGCGGAGCTGAAGATACGACCCGAGTTGCGGAGGATCATGGACCGGATGATCCCGATCACGCGTAATCCTAC
CCCACCGAAGCCTGAATTGGCAGGATCGTCGGGGGGACAAGAGCGGGAGATCGATCGAGTCCCAGATCAAAACTCGGGGGCGCTCGATCCTCGATCTGAC
GGGTCAAGTGCGAGGTCGGAGCTTAGAAGCACCGAAGAAAGGTGGATCAGGGCTCACAAGGCGTTCACGACCTTGAAGACGAAGATCGCGACGACGCCGA
TCCTGCGTGACTTCGACACAACGAGATCACCTGTGGTGATCGTGTATTCAAGAACACGGCGAGATATACCACCCGGTCGCATTCGGTAGTCGTACATTGA
AGGTGAGCAAGTTGAATTACAATGTGGCGGAGATGGAAGTGCTGGCGTTGTTGCGGATCCTAGATTTCTACTACAATCTACTGGTGGGACGTGAGATCAA
GGTCCTGACCAGGCATTCTACGATCGCCTGGCTATTTAAGTCAGCTGGACTCCAGGGTCGCCTAGGACAGTGGTCCGCACTCCTGTCGTGGACACTCGAG
ATCACGAAGTATACGAAGGGTGAAGATGAGATACTGGGGGCGGTCGCTGCCAGTATCACACCGAGATCCAAGATCGACGAGGTATTGATCGCGATCGCGC
CTCTGAAGGAGCCTAAACGTCGTATCCAAGGACTGATCCCCACGGTAGATCGAGACGAAGAACTATGGGTTGTGAGTTTCGACGGATCGGCCCGTGTGAA
GTGAGGTGGGGGCGTGTTTAGCGCGATCATGTGGAGTCTGCCCGAGCTGAAGGTAATCAAGGCCAAATCAGGCTATACCGAGAGTCTCACCGTCAATGAA
GCCGAGTATAACGGCCTATTGCTAGGACTTAGACTGCTGAAGTGCGAGGACTTGGACTGCTGAAGGACCTCGATCGTCGACGATTGGTGATCTGCGGTGA
CTCCAACCTCGTGATCAGGCAGATTCGTGGCAAGATCGACTGCAAGGCGCGGGGATTGACGTTGTTGAAGCAGATAGCCCTCGATTACTTGAGAAAGTGG
GGTGATCACGAACTAGTACATGTGAAGAGAGACTGGAACGGGAGCGCGGATAGCCTGGCGAGTGCGGCTCTGCAACGACAAGACGGGATCGAGGTCCACA
ATGATGCAGATCGCCAGGATCTAGTCACCCTTAATCGGCTAGACGAGATCCTGGTACCCAAGACCGACAATCCAGTGGTACGAGTCTCAGCGGTGGCTAC
ACGGGCCAACGTTCGAGCGAGATCCAACGCCGCCGTCTTGCAAGAAGAGTTGATCCGAGAGATGCGGATCGATCGGATTAAGCGAGCGCAAGATGAAGAG
GTCTGGATCGCGGGGATGAAGAAGTACCTGATCGGACAGATCGCAGATCTTACCCAGGCTGAATCTCGATCCTATGGCAAGATCGTGGCAGACTATGAGG
TAGACGAGCAGGATCTGCTCTTCTATTGTCCTCCTACGACGAGATCGAGCGACGATCGTGATGGGTTGATGAGACTGGTTGTTCCGAAAACACTCCAGCA
AGATATTCTACACCACTATCACACAACCTTGGAAGGGGGCCATCAAGGAATCGGCCGTACCTACCAGCGGATCCGAGATCACTTCCACTGAAGACGTTTG
TATCGGAGTGTGCAGAGATATGTGGGTGAATGCGTAGATTGCGAGACCGGCAAAGGAAGACCCACGATCCAGGGTGAATCACCCGGAAATTTGCAAGCCA
CGTACCCGTACCCATTACAGATCATTGCGATGGATCACATCCCGTTCCTGCCCAGATCCAACAAGGGTAACACGGAGTTGCTGATCTGGGTCGATCTGTT
CACGGGATACGTGATCGCGAAGGCTAGCTCGTCTCGATCAGCCCAGACCGTCGCGGAATCTTACGAGGAATGCGTGTTCCGACGATTCGGGTCGAGCGAG
ATGATCCGGCACGATCGAGAGCCAGGATTTATGTCTGACTTCTTTAGATCGTTCAACAAGGTTCTGGGAC