Description :
From Genome Similarity Track
Location :
Scaffold_775:4685- 7043
Transcript NameFunction/comments
Phyta_totarag10667hypothetical protein PHYSODRAFT_329793
Phyta_totarag10668hypothetical protein

Sequence
2358 bases(100 bases per row)
ACGTCTCACCGGCAGCGACTGTGTAGGGCTCCGTGTAGTAGACGTCACCCTGACTGGTAGGCCAGGTTCCATCAGGCACAGGCGCGGCCGAagcggaggc
agcagcgaaggcggcggtggtggtagCGATGCAGAAGATCTTGACCATATAGAGACGGAGCTGGCTGGATGTATGTTGTTCACAAGGGAAATTGAAAAAT
GAGAGAAGTCGGCAGCCTTGACTGCGACCACAACGCTAGACTTGCCCCAGTCCGCTCGTAGTGTTGTTGGCAACTAAAAAACAGAGAAGAGGATCGATTG
AGATTGAGCATGGGTGTTTCCTTGCCCAGCTTGCCCTCAAGAATCGCACGACTCCATCAAAACCCGACAACAGCACAGGTAGATAGGTAGGTACGTCCAT
GTAGTCCCGGAAAGACGAGGCGAACGAAGCTGTCGATTAGTAGAGCCACTGTATCGGCAAGGGGCTATCATGAAAACTACCGAAATCGGCTAGGAAGGTG
CTACAGCGACACTAGAAAAATGACAGTAACTTGAACATGTATTTGCACGGAGTGATTAATTAAGATTTCAGTGGTATTACAATTAATTGGCCATAGTGGT
CAATGTGGTCCTCACCTTAGAGATCTGCTTTGCATGACAGATGCAGCGACAGAAGATATCGGTGGGTCACATCCTCTGTCATTTTCAGATTCCTCGAAGC
TTGGTACTGATGACTTGACGAAGAGGTCGTTCACGAACACCCCGAGACAGCTCTCGCACCCACGTGCGAGTAACCACTTGGAGCGATACTGCACTGTCGG
GAATCGTTTTCACGTGGTGAGCATCCATGCACTTGGCTCAATATATTTCACAATTATTGTATTGGTAGGGAATATTATTCAGTCTAAAAATATTCGCAAA
ATTTGAAACCGATAAAACGCAATAATAATCATTGCAATGAGCATGATTATTTGGTATTATTTTTTTCCGACCCATTCCCGGATACATGAATTCCAAACCA
TATTCGGCAATGACAGCAAACCGATAAAAATGCAGTAGTGTGTATTGCCATCTACAAACATCTAGCGGAACGCACAATTCGTTTTTCTTTCTCTGCCGGT
AGACGCACGCAACTCGAACTCATTTTAGACGTGGTGGCTGTAGTGCTGATAACAATGTATATCTACCCTTGGTATTTCGGTGTTGCCTCGAACCAGAGAT
GAGTTGTACGAGTGACCTAACTagttgtcatcgtcgtcttggtccttcttcttcttgtcatcGTATTGACCCTTGTTGTCATCGTCTTGGCTCTACGGGT
TATCATCTTGGTTCTTGATGTCATTGGCTTCGGAGCTGTGGTTGACGGCGCGCTCGTCTCCGTCGACTGCGAGCTTTCCTGCTGCGTGTTACCACGGAGT
GAGCTGGTTGCTGAGCCACTGGTTGTCTCATCGCCCGCCACGCCTCGTTCGCAGAGCCACTGGATGCTTGCGtggttgaagtcgacgagccaCTGGTGGT
GGTAGCAGACGGTGTCCAGTTCGACGAGTGCTTTCTCCTGAGGGCACGGCTCCCTTCACATGGGTGTCGCTTTCTGAGTACTGGCACAGCAGGATCTTGA
TGCCATCTCCCAGCTCTGTCGGCTTGCCGTTTGCATTACCCTTGGTCTGCCCGGCTGCAGCTGAGAGACAGAGAATATTCGAGCGTTAACTAGATCTCGG
TACGTGCCGCCGCTATGGCGCTGTCCAGCACTGGATCATCGTCGCCGGTGATCtccggagctgcagctgcagctaccgAACCCCTTCGAGACTGGGCAAG
ATGACGTGTCAATGCCGACTGCAAGTACAGAGAGAAATTCACAGAGGCTGTGGGTGCTTGCATTGAGACGAGTACCAAGCGCATGATCACTCGTTACGAG
TTTAACCTACCGCAGAATATGATCTCGGAGCAACAATGGACCAACAATTTTAAACAGGCTCGGGAGCCTTCGCACAACGACTACGCGACAGTCGACAgcg
cgatgaagaagttccgGGTGGAGACGCGTTGGCCGGAACCCGAGAGCTGAATGATGAACTTGCAGGCGAATATGGAGGCTGTTTTGGATAAGTTCAACCT
CACAGATGTCACGTTCGAGCATGAACAGCGTCGCCTCGTCAAATACCTGCATTGGCGCCACCCAGTTTCAAAACTGTCATTGTAACGAAGCTCACGCTGC
GAGAGAACGATACCTTCAAGAACGAGGTTGTTCTGTTTTGCACCTGGGTGACCAAGCTAATGAAGGAATTCATGATTTGGGAGTACGCAGCACAGGCTGT
CACCAGCCAACCAAGTCTTCAACACCAAAGCGACTGTCGTGGGAATAATGGCGGTCGA