Description :
From Genome Similarity Track
Location :
Scaffold_23:468477- 470979
Sequence
2502 bases(100 bases per row)
ACGACGACGCCTCCGCCGAGCGTCGGATCTGATCCTCGTTCAGATCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACACGGCCG
GTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAACCGTTGCCAGAGGCTGCCGAGATACTGA
ACCTTGAGGAAATGATGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAAGGTTGCCGAGATGGTGCTCATAAGACCTGAGACCACTCGGGAGGAGC
TGAACGCCTCCTCTGTCTTAAACGAGGACGTCCTGGAGGACCTAAACAAGCAGCATCAGACGCGCTTGGGTTCCGAGATCCTTAATAACCCCAAGGATCC
GGTGTGTCCTTTGGGGACGGAGTATGCGGACGGGGTGAACAAACACCCACCGACACAGCTCCCACCAGATCGAGGCGTACGGCATGAGATCGATCTCGTG
CCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGG
TGCGGGAGTTGAAGTCCCCGCCCTCGACGCCAGCTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGC
GACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGTTGTTGAACAACATGGCCTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTA
CCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAAC
GCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCG
AGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGGACGTAATGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTGCGT
CTTCGCGTCACCAGAGATTAAGGGTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACG
CCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACACGGGCTTCGCTGAGCCCTTGTCGGGCC
TCCTTAAGAAGGGCGTCGACTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTGACAGAATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCC
GGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGGTTGTGCACTGCTGCAGGCCGACACGGCTGGACATGTACGAGTTATA
TCGTTCCAGTCCAGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTC
ACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGTGGCT
GTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGGGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCC
CACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCTCTACGGCAGGAA
CGAGCGCGAAGTCCGATTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGGACCCAATGA
ACCTTCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAG
ACCTTTCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCATACATGAAGATATATGAAACATGTCAGCGGGTTTAACCCGC
AAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGACAC
GGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCTTGTTCCGGCCCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTTT
TCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTCCTTT
AC