Description :
From Genome Similarity Track
Location :
Scaffold_32:468358- 470078
Transcript NameFunction/comments
Aphas_H257_11163peptidase, putative

Sequence
1720 bases(100 bases per row)
CAGCGACTTACCCGGCCAGCTTGAAAACTGCGTCAGCTGAATCCACCACTTGGGGTATGGCGTTGTGATCTGATTGGCTGCGTCTTCGCCCGTGACGACG
GCGCCGCCGCTGTACTTGCTCATAAGGTGGTCGCCCAATGTCCACCACGCGTTCACTACGTCAGTAGCAAACGCGTTGTGTGCTTGTTCCACGTACGCGA
CCGCGTCCGAAACACTGGTGGTGTTCGAAACAATATACTTTCGGGACGTCTCGTACCGCTCGATGGCGTCGGCTTGCATCTTGGTCACGGCAGCCCACAC
CTCGGGGTACATGACGTTGTACCGCAGCGTGAGCCAGTTGTTGACAAAATTGAACGCCCACCACGCCGACTCGCGACTGAACTGGCTCTGCCGGACACTC
GTATACGAGGGCGGCACCGTCGACTGCGCGCACGAGAACGGCACGTACACGGATCCATGTGGCGACGACAACCCGTACCACATGACGCCACCAATAGCGT
CCGCTACGGGTGTTCGAGACGCTTGGTGGACAAAGCTGTACACCGTGCGCTCCAGCGAGATGGCGCGCTCCCAGCCGCCGCCGACGCCATATGTGGTCCC
GCCGTTGCGGTTCGGATTGCCCCATGGACCTGCGGCGATTCCTTGGGTCAAATCAAATGGCGTGCCTTCGAAATGATCTCGTAACAGGTTGAAGACGTCT
GTTACCGAAATCAACCGATCCGGACGGACGGATACCGGGTACGTGGCCACTGTCGGGTAAAAGCCCCATTCGGGTTGCAGCTTCAGCGACGGCGCCACCA
CGTCCATGACCCGCCACACGCGGCGTCCGACGTAAAGAGGAAGCAACGGACCTTCCTTGGAGTACCCGTACGCAGCGGTAAAGTCGAACGGCCCGTCGAT
GTCGGGGTCCCACCAGCCCATGTCCCGCGCAAACGTGTGCACGTTCGTGGACGCGAGGAAGCGGGACGAGTCGGAGAGGTCCATCTCCCGGATCACAAAC
CCGTTCGCGATGACCGACACGTGGTCGTCAGCAATACGTTGGGCGGCCCACACGGCGCTGCCGTTGCCCGGACCGGTAAGCACATGGAACACCCATGCTT
CGCCGTACTTGTCCCCGATTGCCAAGGCCTCCCCGGAGCTCATGTACACGGGATGCGTGATGTTCCCGTTGAAGTCGTTGTAGAACCCGTACTCGACCGC
GAGATCGCCCATGGTTTTCACAGCGCACTGCGCATTGTCGCACCGCTCGAGCGCGACTTTCGTGAGCTCGTTGATGCTGAACAAGTTCTTTCCCCCGGGT
TGCCCCAGTGCCCATCCCACGGTCTTGGCCCCGCACGAACTCTCCCCCATGCCCAGTTGCTTTTCGTTGATGAGGGCGTAGTCTTGGTCGAAATACGCAT
ACGTGTGCTTGACTTGGGGAATGTGGCCGAGCGGCGTGGACAGCGCCTGCTGGTCGTTCACAGGCTTGTACCAGTCACCCCGCTCATTGGACACGATGCG
GGGGTACCCTGGACGCGCGTATGAGTAGATGCTTCGCGTGGACCCGTGTGCGTGGTCCATTGCTGGCACGCGAACCAAGCGCAGGTCCATTGCCCCAAGG
CCTGTGTCTTCCGTGTGGGCGACGAGCACCGATCCGTCCACTGTGGCGTTCCTACCAGCGACGATCACTGTGCATGCTTCAACGACGGTCACGGCCACAG
CGGCGATAAGGACAAGCCTC