Description :
From Genome Similarity Track
Location :
Scaffold_265:46826- 49512
Sequence
2686 bases(100 bases per row)
TTACCTCCCGATAGAGGTGTACGTCATGAAACTGACCTAGTTTCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACTTAAGGAACAGTGTGACG
TCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTCTCCCCATTCCACACCTACTTTTTGTGTCAAAAATCCTAATGG
TAAGTGGCGTATTGTGCAAGCTTATAATAAGCTCAATGCTGCTACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTG
GGATATATATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGATATTCCGCTAACAGCGGTTAGTACCCCAAGCG
GTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCTAATTCCCCGGCTACTTTTAATCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTA
TGCACAAACGTACTTGATGACATCTTTGTTCATAGTCGTGCAACGGACGGTCGAACTGATGTGGATGATCACATTGATCATTTACGAGCGGTGCTCGAGT
GCATGCGCACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGATGCAGAAGAGATTCCCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCG
AGCGGACCCCGCTAAGACAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAATCAAAAAGATCTACGTAAGTGGCTTTGCCTTGCCAATTACTTGCATAAG
TATAGTGCGAGTTACGCAGATATGGCTCGGCCATTATCCAGTCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAG
CAGTTAAGGAAAGTCTCCTTCGTGCTCCAATACTGGCTTTGCCTGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGCATCTGACTTTGCCATAAGCAG
TGCTCTGTTATCAACAGATGTCGATGGATGCGAACGCGTCAGTGCATTCGAATCTAGACAGCTCAAAGCTGTTGAAAGGAACTATCCAGTTCATGACAAA
GAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTGTGCACTG
CGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTTCCGAATATAACTTCGAAGTGAAGTATAAGCCAGGAAAGCAAAATGT
TTTGGCTGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCTTCAGTCACTGACTTAATCCGTGCAGCTTATACCAAG
GATGAACAATGTGTAGCTTTGCTACGTGCTCTTGACAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGTACGTTTACGTGCGAGGCTACATCGAT
ATTCTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTAAAGTATCGAATCCTCTA
TGATGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGCGGGTG
ATCACCTACGTGCGCACGTGTGAAACGTGTCAACGCGTCAAACCCTCAGCACATGCGGCGGCGGCGCTGGCTAGTCGGCCTGTATCCTCTGGGTGTTGGG
ATTCCATGAGTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGGATGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCT
AGCGGCAGTGCCGGACTCGATTGATGGTGAAGGCATAGCTTTGCTGCCCATTGATCACATGTTTCGACAACATGGTTTTCCAGTGGCAATTGTCTCTGAT
AGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGTACTCGTTTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTC
AAACTGAGCGTGTTAATCGCGTCATTAATGACATTTTGCACAGTGTTTGCGCTGATACGCCTAAGAGTTGGAGCTCCATGTTCCCTGTTGTTGAGTTTGC
GTTGAACAAAGATGTTCATGCCTCTACAGGCTATACTCCGTTCTACGTAAACGGTCTCACCCACCCTCGCGTTCCGTTAGCGCTACCACTATGTGGTTCA
GGGCTTGGTGGGGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAAAACAGGTAGGCGAGTTTCTCGCAACGCGATTGAATGTC
TTAAGACATGTGCGTGACGCAATAGCTGAAAGCTAAGACCAACAAAAACAAAAGCAGATGCTAAAAACAGAGGTTGTTTTGAACGTTATCAGGTCGGAGA
CCAAGTATTACTCAATGCTAAAAACCTACCAACAAATGTAGTGTCCGCTGTCTTAGGAAAAAGTTGAGTCCACGCTTCATTGGACCATTTGCGGTCACTG
CCAAGAAGGAACTTGCGTATACGCTAAACCTTCCGCGAAAATTGCGCACACACCCAGTGTTCTACGTAGTCTTACTTAAGCCATAC